Non Neuronal Enolase (ENO1) (NM_001428) Human 3' UTR Clone

CAT#: SC204788

3' UTR clone of enolase 1 (alpha) (ENO1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ENO1
• Synonyms: ENO1L1; HEL-S-17; MPB1; NNE; PPH
• ACCN: NM_001428
• Insert Size: 390 bp
• Sequence Data:
  Insert Sequence

  >SC204788 3’UTR clone of NM_001428
  The sequence shown below is from the reference sequence of NM_001428. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AGGAACTTCAGAAACCCCTTGGCCAAGTAAGCTGTGGGCAGGCAAGCCCTTCGGTCACCTGTTGGCTAC
  ACAGACCCCTCCCCTCGTGTCAGCTCAGGCAGCTCGAGGCCCCCGACCAACACTTGCAGGGGTCCCTGC
  TAGTTAGCGCCCCACCGCCGTGGAGTTCGTACCGCTTCCTTAGAACTTCTACAGAAGCCAAGCTCCCTG
  GAGCCCTGTTGGCAGCTCTAGCTTTGCAGTCGTGTAATTGGCCCAAGTCATTGTTTTTCTCGCCTCACT
  TTCCACCAAGTGTCTAGAGTCATGTGAGCCTCGTGTCATCTCCGGGGTGGCCACAGGCTAGATCCCCGG
  TGGTTTTGTGCTCAAAATAAAAAGCCTCAGTGACCCATGAGAATA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001428.5
• Summary: This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011]
• Locus ID: 2023
• MW: 14.6