SDCCAG8 (NM_006642) Human 3' UTR Clone

CAT#: SC204156

3' UTR clone of serologically defined colon cancer antigen 8 (SDCCAG8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SDCCAG8
• Synonyms: BBS16; CCCAP; CCCAP SLSN7; hCCCAP; HSPC085; NPHP10; NY-CO-8; SLSN7
• ACCN: NM_006642
• Insert Size: 336 bp
• Sequence Data:
  Insert Sequence

  >SC204156 3’UTR clone of NM_006642
  The sequence shown below is from the reference sequence of NM_006642. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TTACCCAGCATGCCACAATCTGATTGCTGACCTGGATGGAACAGAGTGAAATAAATGATTTACAAAGAG
  ATATTTACATTCATCTGGTTTAGACTTAATATGCCACAACGCACCACGACCTTCCCAGGGTGACACCGC
  CTCAGCCTGCAGTGGGGCTGGTCCTCATCAACGCGGGCGCTGTCCCCGCACGCAGTCGGGCTGGAGCTG
  GAGTCTGACTCTAGCTGAGCAGAGCTCCTGGTGTATGTTTTCAGAAATGGCTTGAAGTTATGTGTTTAA
  ATCTGCTCATTCGTATGCTAGGTTATACATATGATTTTCAATAAATGAACTTTTTAAAGA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006642.5
• Summary: This gene encodes a centrosome associated protein. This protein may be involved in organizing the centrosome during interphase and mitosis. Mutations in this gene are associated with retinal-renal ciliopathy. [provided by RefSeq, Oct 2010]
• Locus ID: 10806
• MW: 13