ADAM15 (NM_207195) Human 3' UTR Clone

CAT#: SC203551

3' UTR clone of ADAM metallopeptidase domain 15 (ADAM15) transcript variant 4 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "ADAM15"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADAM15
Synonyms MDC15
ACCN NM_207195
Insert Size 303 bp
Sequence Data
>SC203551 3’UTR clone of NM_207195
The sequence shown below is from the reference sequence of NM_207195. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCCGACAGTGTCCTCGCTCTACCTCTGACCTCTCCGGAGGTTCCGCTGCCTCCAAGCCGGACTTAGG
GCTTCAAGAGGCGGGCGTGCCCTCTGGAGTCCCCTACCATGACTGAAGGCGCCAGAGACTGGCGGTGTC
TTAAGACTCCGGGCACCGCCACGCGCTGTCAAGCAACACTCTGCGGACCTGCCGGCGTAGTTGCAGCGG
GGGCTTGGGGAGGGGCTGGGGGTTGGACGGGATTGAGGAAGGTCCGCACAGCCTGTCTCTGCTCAGTTG
CAATAAACGTGACATCTTGGGAGCGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_207195.3
Summary The protein encoded by this gene is a member of the ADAM (a disintegrin and metalloproteinase) protein family. ADAM family members are type I transmembrane glycoproteins known to be involved in cell adhesion and proteolytic ectodomain processing of cytokines and adhesion molecules. This protein contains multiple functional domains including a zinc-binding metalloprotease domain, a disintegrin-like domain, as well as a EGF-like domain. Through its disintegrin-like domain, this protein specifically interacts with the integrin beta chain, beta 3. It also interacts with Src family protein-tyrosine kinases in a phosphorylation-dependent manner, suggesting that this protein may function in cell-cell adhesion as well as in cellular signaling. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Locus ID 8751
MW 10.8

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.