Ubiquitin (UBB) (NM_018955) Human 3' UTR Clone

CAT#: SC201303

3' UTR clone of ubiquitin B (UBB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UBB
• Synonyms: HEL-S-50
• ACCN: NM_018955
• Insert Size: 173 bp
• Sequence Data:
  Insert Sequence

  >SC201303 3’UTR clone of NM_018955
  The sequence shown below is from the reference sequence of NM_018955. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CTGGTCCTGCGCCTGAGGGGTGGCTGTTAATTCTTCAGTCATGGCATTCGCAGTGCCCAGTGATGGCAT
  TACTCTGCACTATAGCCATTTGCCCCAACTTAAGTTTAGAAATTACAAGTTTCAGTAATAGCTGAACCT
  GTTCAAAATGTTAATAAAGGTTTCGTTGCATGGTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_018955.4
• Summary: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of three direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. An aberrant form of this protein has been detected in patients with Alzheimer's disease and Down syndrome. Pseudogenes of this gene are located on chromosomes 1, 2, 13, and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
• Locus ID: 7314
• MW: 6.4