Pkig Mouse qPCR Primer Pair (NM_001039390)

CAT#: MP221259

qSTAR qPCR primer pairs against mus musculus gene Pkig

Specifications

Product Data

• Gene ID: 18769
• Forward Sequence: AATGCAGTCCCTGACATCCAGG
• Reverse Sequence: AGGTGTTCGCATCACTGCTCTC
• Accession No: BC026550, NM_001039390, NM_001039390.1, NM_001039390.2, BG086437, BY240874, BY266193, BY283174, BY343638, BY617655
• UniProt ID: O70139
• Synonyms: PKIgamma
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.