1700017B05Rik Mouse qPCR Primer Pair (NM_028820)

CAT#: MP215159

qSTAR qPCR primer pairs against Mus musculus gene 1700017B05Rik

Specifications

Product Data

• Gene ID: 74211
• Forward Sequence: CTGCCTGACATCTATCCTGACC
• Reverse Sequence: GGCAACTTTCCAGCCAAGGCTT
• Accession No: BC118527, NM_028820, NM_028820.1, NM_028820.2, BC046380, BC150963, BC150965, BY706170
• UniProt ID: Q3TEI4
• Synonyms: AA682102; D9Ertd278e
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.