FRAS1 Human qPCR Primer Pair (NM_025074)

CAT#: HP231736

qSTAR qPCR primer pairs against Homo sapiens gene FRAS1

Specifications

Product Data

• Gene ID: 80144
• Forward Sequence: CTTTGAGCCTGCAAGACCTGGA
• Reverse Sequence: AGAGGCTCAGAAGCAGTTTGCC
• Accession No: NM_025074, NM_025074.1, NM_025074.2, NM_025074.3, NM_025074.4, NM_025074.5, NM_025074.6, BC009254, BC020192, BC052281, BC064487, BC094853, BC131820, BC131821, BX647420, BX647949, NM_025074.7
• UniProt ID: Q86XX4
• Synonyms: FRASRS1
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.