ERAB (HSD17B10) Human qPCR Primer Pair (NM_004493)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
HSD17B10 (Myc-DDK-tagged)-Human hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10), nuclear gene encoding mitochondrial protein, transcript variant 1
USD 300.00
Other products for "HSD17B10"
Specifications
Product Data | |
Gene ID | 3028 |
Forward Sequence | CGTGTGGATGTAGCTGTCAACTG |
Reverse Sequence | ACCAGGCGGATCACATTGAAGG |
Accession No | NM_004493, NM_004493.1, NM_004493.2, BC000372, BC000372.2, BC008708, BC008708.1, BC000829, NM_004493.3 |
UniProt ID | Q99714 |
Synonyms | 17b-HSD10; ABAD; CAMR; DUPXp11.22; ERAB; HADH2; HCD2; HSD10MD; MHBD; MRPP2; MRX17; MRX31; MRXS10; SCHAD; SDR5C1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.