p16INK4A (CDKN2A) Human qPCR Primer Pair (NM_058195)
USD 142.00
2 Weeks*
Size
Product Images
Frequently bought together (4)
CDKN2A (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 1
USD 225.00
Other products for "CDKN2A"
Specifications
Product Data | |
Gene ID | 1029 |
Forward Sequence | CTCGTGCTGATGCTACTGAGGA |
Reverse Sequence | GGTCGGCGCAGTTGGGCTCC |
Accession No | BC015960, NM_058195, NM_058195.1, NM_058195.2, NM_058195.3, BC015960.2, BC021998, BI258230, BQ012762, BT007020, BX099567 |
UniProt ID | P42771 |
Synonyms | ARF; CDK4I; CDKN2; CMM2; INK4; INK4A; MLM; MTS-1; MTS1; P14; P14ARF; P16; P16-INK4A; P16INK4; P16INK4A; P19; P19ARF; TP16 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.