NUDT19 Human qPCR Primer Pair (XM_372723)

CAT#: HP225860

qSTAR qPCR primer pairs against Homo sapiens gene NUDT19



SensiMix SYBR Master Mix

USD 142.00

5 Days*

Size
    • 200 reactions

Product Images

Frequently bought together (4)
NUDT19 rabbit polyclonal antibody
    • 100 ul

USD 380.00


NUDT19 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 19 (NUDT19), nuclear gene encoding mitochondrial protein
    • 10 ug

USD 457.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

USD 305.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00

Other products for "NUDT19"

Specifications

Product Data
Gene ID 390916
Forward Sequence GCACCACTCGCCGCTTTGACA
Reverse Sequence GTTGCCTCTGATGGAGATGACC
UniProt ID A8MXV4
Synonyms androgen regulated gene RP2; D7Rp2; D7Rp2-r; D7Rp2-s; D7Rp2e; nudix (nucleoside diphosphate linked moiety X)-type motif 19; OTTMUSP00000032016; RP2-r; RP2-s
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.