BUD23 Human qPCR Primer Pair (NM_017528)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
WBSCR22 (Myc-DDK-tagged)-Human Williams Beuren syndrome chromosome region 22 (WBSCR22), transcript variant 2
USD 300.00
Rabbit Polyclonal antibody to WBSCR22 (Williams Beuren syndrome chromosome region 22)
USD 625.00
Other products for "BUD23"
Specifications
Product Data | |
Gene ID | 114049 |
Forward Sequence | ATGAGGCTGTGGACCGAGAGAT |
Reverse Sequence | TACAGAGCCACTGCACAGCAGA |
Accession No | NM_017528, NM_017528.1, NM_017528.2, NM_017528.3, NM_017528.4, BC011696, BC011696.2, BC000169, BC001780, BG108222, BM671506, BM794274, BP280183, BQ927478, BQ930813, BQ961799, NM_017528.5 |
UniProt ID | O43709 |
Synonyms | HASJ4442; HUSSY-3; MERM1; PP3381; WBMT; WBSCR22 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.