OFD1 Human qPCR Primer Pair (NM_003611)

CAT#: HP207099

qSTAR qPCR primer pairs against Homo sapiens gene OFD1

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 8481
Forward Sequence GAACTACGGAAAGCCGAAAAGGC
Reverse Sequence CCTTCAGCTGTGCAGAATGCTC
Accession No NM_003611, XM_005274606, XM_010327, XM_011545592, XM_011545594, XM_011545595, XM_011545597, XM_011545598, XM_017029909, XM_017029911
Synonyms 71-7A; CXorf5; JBTS10; RP23; SGBS2
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
Other products for "OFD1"
Frequently bought together (2)
Rabbit polyclonal antibody to OFD1 (oral-facial-digital syndrome 1)
    • 100 ul

USD 415.00


OFD1 (Myc-DDK-tagged)-Human oral-facial-digital syndrome 1 (OFD1)
    • 10 ug

USD 1,590.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies