TCF3 / E2A (TCF3) Human qPCR Primer Pair (NM_003200)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
TCF3 (Myc-DDK-tagged)-Human transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) (TCF3), transcript variant 1
USD 609.00
Other products for "TCF3"
Specifications
Product Data | |
Gene ID | 6929 |
Forward Sequence | CCAGACCAAACTGCTCATCCTG |
Reverse Sequence | TCGCCGTTTCAAACAGGCTGCT |
Accession No | NM_003200, NM_003200.1, NM_003200.2, NM_003200.3, BC110579, BC005166, BC011665, BC014680, BC110580, BG284440, BU528547, NM_003200.5 |
UniProt ID | P15923 |
Synonyms | AGM8; bHLHb21; E2A; E47; ITF1; p75; TCF-3; VDIR |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.