SMARCA2 Human qPCR Primer Pair (NM_003070)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
SMARCA2 (Myc-DDK-tagged)-Human SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 1
USD 1,360.00
Other products for "SMARCA2"
Specifications
Product Data | |
Gene ID | 6595 |
Forward Sequence | GAAGAGTCCAGTAGGCAGGAAAC |
Reverse Sequence | CATCCACGTCTTGCTTAGCTGTC |
Accession No | NM_003070, NM_003070.1, NM_003070.2, NM_003070.3, NM_003070.4, BC040029, BC068252, BC156185, BI758293, BM921013, NM_003070.5 |
UniProt ID | P51531 |
Synonyms | BAF190; BIS; BRM; hBRM; hSNF2a; NCBRS; SNF2; SNF2L2; SNF2LA; Sth1p; SWI2 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.