OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cdk5 Mouse Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN303042BN
Cdk5 - mouse gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (3)

MR204021 Cdk5 (Myc-DDK-tagged) - Mouse cyclin-dependent kinase 5 (Cdk5)
10 ug
$289.00 $300.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "Cdk5 or BC052007"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol Cdk5
Locus ID 12568
Components

KN303042G1, Cdk5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GACCTTGCAGGAACATCTCG

KN303042G2, Cdk5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGAGAAACTGGAGAAGATTG

KN303042BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_007668
UniProt ID P49615
Synonyms AW048668; Crk6
Summary Proline-directed serine/threonine-protein kinase essential for neuronal cell cycle arrest and differentiation and may be involved in apoptotic cell death in neuronal diseases by triggering abortive cell cycle re-entry. Interacts with D1 and D3-type G1 cyclins. Phosphorylates SRC, NOS3, VIM/vimentin, p35/CDK5R1, MEF2A, SIPA1L1, SH3GLB1, PXN, PAK1, MCAM/MUC18, SEPT5, SYN1, DNM1, AMPH, SYNJ1, CDK16, RAC1, RHOA, CDC42, TONEBP/NFAT5, MAPT/TAU, MAP1B, histone H1, p53/TP53, HDAC1, APEX1, PTK2/FAK1, huntingtin/HTT, ATM, MAP2, NEFH and NEFM. Regulates several neuronal development and physiological processes including neuronal survival, migration and differentiation, axonal and neurite growth, synaptogenesis, oligodendrocyte differentiation, synaptic plasticity and neurotransmission, by phosphorylating key proteins. Activated by interaction with CDK5R1 (p35) and CDK5R2 (p39), especially in post-mitotic neurons, and promotes CDK5R1 (p35) expression in an autostimulation loop. Phosphorylates many downstream substrates such as Rho and Ras family small GTPases (e.g. PAK1, RAC1, RHOA, CDC42) or microtubule-binding proteins (e.g. MAPT/TAU, MAP2, MAP1B), and modulates actin dynamics to regulate neurite growth and/or spine morphogenesis. Phosphorylates also exocytosis associated proteins such as MCAM/MUC18, SEPT5, SYN1, and CDK16/PCTAIRE1 as well as endocytosis associated proteins such as DNM1, AMPH and SYNJ1 at synaptic terminals. In the mature central nervous system (CNS), regulates neurotransmitter movements by phosphorylating substrates associated with neurotransmitter release and synapse plasticity; synaptic vesicle exocytosis, vesicles fusion with the presynaptic membrane, and endocytosis. Promotes cell survival by activating anti-apoptotic proteins BCL2 and STAT3, and negatively regulating of JNK3/MAPK10 activity. Phosphorylation of p53/TP53 in response to genotoxic and oxidative stresses enhances its stabilization by preventing ubiquitin ligase-mediated proteasomal degradation, and induces transactivation of p53/TP53 target genes, thus regulating apoptosis. Phosphorylation of p35/CDK5R1 enhances its stabilization by preventing calpain-mediated proteolysis producing p25/CDK5R1 and avoiding ubiquitin ligase-mediated proteasomal degradation. During aberrant cell-cycle activity and DNA damage, p25/CDK5 activity elicits cell-cycle activity and double-strand DNA breaks that precedes neuronal death by deregulating HDAC1. DNA damage triggered phosphorylation of huntingtin/HTT in nuclei of neurons protects neurons against polyglutamine expansion as well as DNA damage mediated toxicity. Phosphorylation of PXN reduces its interaction with PTK2/FAK1 in matrix-cell focal adhesions (MCFA) during oligodendrocytes (OLs) differentiation. Negative regulator of Wnt/beta-catenin signaling pathway. Activator of the GAIT (IFN-gamma-activated inhibitor of translation) pathway, which suppresses expression of a post-transcriptional regulon of proinflammatory genes in myeloid cells; phosphorylates the linker domain of glutamyl-prolyl tRNA synthetase (EPRS) in a IFN-gamma-dependent manner, the initial event in assembly of the GAIT complex. Phosphorylation of SH3GLB1 is required for autophagy induction in starved neurons. Phosphorylation of TONEBP/NFAT5 in response to osmotic stress mediates its rapid nuclear localization. MEF2 is inactivated by phosphorylation in nucleus in response to neurotoxin, thus leading to neuronal apoptosis. APEX1 AP-endodeoxyribonuclease is repressed by phosphorylation, resulting in accumulation of DNA damage and contributing to neuronal death. NOS3 phosphorylation down regulates NOS3-derived nitrite (NO) levels. SRC phosphorylation mediates its ubiquitin-dependent degradation and thus leads to cytoskeletal reorganization. May regulate endothelial cell migration and angiogenesis via the modulation of lamellipodia formation. Involved in dendritic spine morphogenesis by mediating the EFNA1-EPHA4 signaling. The complex p35/CDK5 participates in the regulation of the circadian clock by modul
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA200671 Cdk5 CRISPRa kit - CRISPR gene activation of mouse cyclin-dependent kinase 5 1 kit
$1,657.00
KN303042 Cdk5 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN303042LP Cdk5 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN303042RB Cdk5 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN503042 Cdk5 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products