NF-kB p65 (RELA) Human Gene Knockout Kit (CRISPR)
CAT#: KN220780
RELA - human gene knockout kit via CRISPR, HDR mediated
Functional Cassette: Luciferase-Puro RFP-BSD mBFP-Neo
HDR-mediated knockout kit validation
USD 1,657.00
4 Weeks*
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | NF-kB p65 |
Locus ID | 5970 |
Components |
KN220780G1, NF-kB p65 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCGCGGGGTGGCATCGCCG KN220780G2, NF-kB p65 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGGCCGCCGCGGCTGTGGC KN220780D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001145138, NM_001243984, NM_001243985, NM_021975 |
UniProt ID | Q04206 |
Synonyms | NFKB3; p65 |
Summary | NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN220780BN | RELA - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN220780LP | RELA - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN220780RB | RELA - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN420780 | RELA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
|
GA104066 | RELA CRISPRa kit - CRISPR gene activation of human RELA proto-oncogene, NF-kB subunit |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review