SAP155 (SF3B1) Human Gene Knockout Kit (CRISPR)
CAT#: KN219649
SF3B1 - human gene knockout kit via CRISPR, HDR mediated
Functional Cassette: Luciferase-Puro RFP-BSD mBFP-Neo
HDR-mediated knockout kit validation
USD 1,657.00
4 Weeks*
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
Donor DNA | GFP-puro |
Symbol | SAP155 |
Locus ID | 23451 |
Components |
KN219649G1, SAP155 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AAGATCGCCAAGACTCACGA KN219649G2, SAP155 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ACGAAGAAAACACGTAAGCA KN219649D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001005526, NM_001308824, NM_012433 |
UniProt ID | O75533 |
Synonyms | Hsh155; MDS; PRP10; PRPF10; SAP155; SF3b155 |
Summary | This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN219649BN | SF3B1 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN219649LP | SF3B1 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN219649RB | SF3B1 - human gene knockout kit via CRISPR, HDR mediated |
USD 1,657.00 |
|
KN419649 | SF3B1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
|
GA108316 | SF3B1 CRISPRa kit - CRISPR gene activation of human splicing factor 3b subunit 1 |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review