PAPPA Human Gene Knockout Kit (CRISPR)

CAT#: KN209767

PAPPA - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

Change donor?
Get a free quote

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Symbol PAPPA
Locus ID 5069
Kit Components

KN209767G1, PAPPA gRNA vector 1 in pCas-Guide vector, Target Sequence: GGCTGGCCGAGCGTCCCCGC

KN209767G2, PAPPA gRNA vector 2 in pCas-Guide vector, Target Sequence: GGGGCTGCTGAGCGCCGCGC

KN209767-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_002581, XM_006717129, XM_017014784
Summary This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
