Mouse Gusb activation kit by CRISPRa

CAT#: GA212271

Gusb CRISPRa kit - CRISPR gene activation of mouse glucuronidase, beta

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: Gusb
• Locus ID: 110006
• Kit Components:

  GA212271G1, Gusb gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAGTTTGTTATTAAAGCC

  GA212271G2, Gusb gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTAGCCTAGTGGTCCTGA

  GA212271G3, Gusb gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGCCCCTCAGGACCACT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_010368, NM_001357025, NM_001357026, NM_001357027
• UniProt ID: P12265
• Synonyms: AI747421; asd; g; Gur; Gus; Gus-r; Gus-s; Gus-t; Gus-u; Gut
• Summary: Plays an important role in the degradation of dermatan and keratan sulfates.[UniProtKB/Swiss-Prot Function]