Human Oxytocin neurophysin 1 (OXT) activation kit by CRISPRa
CAT#: GA103350
OXT CRISPRa kit - CRISPR gene activation of human oxytocin/neurophysin I prepropeptide
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | OXT |
Locus ID | 5020 |
Kit Components | GA103350G1, Oxytocin neurophysin 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTAGAATATAAGCCCCA GA103350G2, Oxytocin neurophysin 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCTTTTATCTCTGTAGCAC GA103350G3, Oxytocin neurophysin 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGTCCCCTCAGATATCTGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_000915 |
UniProt ID | P01178 |
Synonyms | OT; OT-NPI; OXT-NPI |
Summary | This gene encodes a precursor protein that is processed to produce oxytocin and neurophysin I. Oxytocin is a posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin I. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. [provided by RefSeq, Dec 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN424226 | OXT - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review