Human Kallikrein 2 (KLK2) activation kit by CRISPRa

CAT#: GA102587

KLK2 CRISPRa kit - CRISPR gene activation of human kallikrein related peptidase 2

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: KLK2
• Locus ID: 3817
• Kit Components:

  GA102587G1, Kallikrein 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAATCTGACCTCACACCGT

  GA102587G2, Kallikrein 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACATACTAGATCAGTCTGG

  GA102587G3, Kallikrein 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCAGCATCTAGGTGCCAAC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_001002231, NM_001002232, NM_001256080, NM_005551, NR_045762, NR_045763
• UniProt ID: P20151
• Synonyms: hGK-1; hK2; KLK2A2
• Summary: This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]