Suppressor of Fused (SUFU) (NM_001178133) Human Untagged Clone

CAT#: SC328714

SUFU (untagged)-Human suppressor of fused homolog (Drosophila) (SUFU) transcript variant 2


  "NM_001178133" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SUFU Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SUFU"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SUFU
Synonyms JBTS32; PRO1280; SUFUH; SUFUXL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001178133, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGCTGCGGCCTAGCGGCGCCCCCGGCCCCACCGCGCCCCCGGCCCCTGGCCCG
ACTGCCCCCCCGGCCTTCGCTTCGCTCTTTCCCCCGGGACTGCACGCCATCTACGGAGAG
TGCCGCCGCCTTTACCCTGACCAGCCGAACCCGCTCCAGGTTACCGCTATCGTCAAGTAC
TGGTTGGGTGGCCCAGACCCCTTGGACTATGTTAGCATGTACAGGAATGTGGGGAGCCCT
TCTGCTAACATCCCCGAGCACTGGCACTACATCAGCTTCGGCCTGAGTGATCTCTATGGT
GACAACAGAGTCCATGAGTTTACAGGAACAGATGGACCTAGTGGTTTTGGCTTTGAGTTG
ACCTTTCGTCTGAAGAGAGAAACTGGGGAGTCTGCCCCACCAACATGGCCCGCAGAGTTA
ATGCAGGGCTTGGCACGATACGTGTTCCAGTCAGAGAACACCTTCTGCAGTGGGGACCAT
GTGTCCTGGCACAGCCCTTTGGATAACAGTGAGTCAAGAATTCAGCACATGCTGCTGACA
GAGGACCCACAGATGCAGCCCGTGCAGACACCCTTTGGGGTAGTTACCTTCCTCCAGATC
GTTGGTGTCTGCACTGAAGAGCTACACTCAGCCCAGCAGTGGAACGGGCAGGGCATCCTG
GAGCTGCTGCGGACAGTGCCTATTGCTGGCGGCCCCTGGCTGATAACTGACATGCGGAGG
GGAGAGACCATATTTGAGATCGATCCACACCTGCAAGAGAGAGTTGACAAAGGCATCGAG
ACAGATGGCTCCAACCTGAGTGGTGTCAGTGCCAAGTGTGCCTGGGATGACCTGAGCCGG
CCCCCCGAGGATGACGAGGACAGCCGGAGCATCTGCATCGGCACACAGCCCCGGCGACTC
TCTGGCAAAGACACAGAGCAGATCCGGGAGACCCTGAGGAGAGGACTCGAGATCAACAGC
AAACCTGTCCTTCCACCAATCAACCCTCAGCGGCAGAATGGCCTCGCCCACGACCGGGCC
CCGAGCCGCAAAGACAGCCTGGAAAGTGACAGCTCCACGGCCATCATTCCCCATGAGCTG
ATTCGCACGCGGCAGCTTGAGAGCGTACATCTGAAATTCAACCAGGAGTCCGGAGCCCTC
ATTCCTCTCTGCCTAAGGGGCAGGCTCCTGCATGGACGGCACTTTACATATAAAAGTATC
ACAGGTGACATGGCCATCACGTTTGTCTCCACGGGAGTGGAAGGCGCCTTTGCCACTGAG
GAGCATCCTTACGCGGCTCATGGACCCTGGTTACAACTCTGA
Restriction Sites Please inquire     
ACCN NM_001178133
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001178133.1, NP_001171604.1
RefSeq Size 1900 bp
RefSeq ORF 1302 bp
Locus ID 51684
UniProt ID Q9UMX1
Cytogenetics 10q24.32
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Pathways in cancer
Gene Summary The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.