Semaphorin 7a (SEMA7A) (NM_001146030) Human Untagged Clone
CAT#: SC327566
SEMA7A (untagged)-Human semaphorin 7A GPI membrane anchor (John Milton Hagen blood group) (SEMA7A) transcript variant 3
"NM_001146030" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SEMA7A |
Synonyms | CD108; CDw108; H-SEMA-K1; H-Sema-L; JMH; SEMAK1; SEMAL |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146030, the custom clone sequence may differ by one or more nucleotides
ATGAGAGGCTACGCCCCCTTCAGCCCGGACGAGAACTCCCTGGTTCTGTTTGAAGGGGAC GAGGTGTATTCCACCATCCGGAAGCAGGAATACAATGGGAAGATCCCTCGGTTCCGCCGC ATCCGGGGCGAGAGTGAGCTGTACACCAGTGATACTGTCATGCAGAACCCACAGTTCATC AAAGCCACCATCGTGCACCAAGACCAGGCTTACGATGACAAGATCTACTACTTCTTCCGA GAGGACAATCCTGACAAGAATCCTGAGGCTCCTCTCAATGTGTCCCGTGTGGCCCAGTTG TGCAGGGGGGACCAGGGTGGGGAAAGTTCACTGTCAGTCTCCAAGTGGAACACTTTTCTG AAAGCCATGCTGGTATGCAGTGATGCTGCCACCAACAAGAACTTCAACAGGCTGCAAGAC GTCTTCCTGCTCCCTGACCCCAGCGGCCAGTGGAGGGACACCAGGGTCTATGGTGTTTTC TCCAACCCCTGGAACTACTCAGCCGTCTGTGTGTATTCCCTCGGTGACATTGACAAGGTC TTCCGTACCTCCTCACTCAAGGGCTACCACTCAAGCCTTCCCAACCCGCGGCCTGGCAAG TGCCTCCCAGACCAGCAGCCGATACCCACAGAGACCTTCCAGGTGGCTGACCGTCACCCA GAGGTGGCGCAGAGGGTGGAGCCCATGGGGCCTCTGAAGACGCCATTGTTCCACTCTAAA TACCACTACCAGAAAGTGGCCGTCCACCGCATGCAAGCCAGCCACGGGGAGACCTTTCAT GTGCTTTACCTAACTACAGACAGGGGCACTATCCACAAGGTGGTGGAACCGGGGGAGCAG GAGCACAGCTTCGCCTTCAACATCATGGAGATCCAGCCCTTCCGCCGCGCGGCTGCCATC CAGACCATGTCGCTGGATGCTGAGCGGAGGAAGCTGTATGTGAGCTCCCAGTGGGAGGTG AGCCAGGTGCCCCTGGACCTGTGTGAGGTCTATGGCGGGGGCTGCCACGGTTGCCTCATG TCCCGAGACCCCTACTGCGGCTGGGACCAAGGCCGCTGCATCTCCATCTACAGCTCCGAA CGGTCAGTGCTGCAATCCATTAATCCAGCCGAGCCACACAAGGAGTGTCCCAACCCCAAA CCAGACAAGGCCCCACTGCAGAAGGTTTCCCTGGCCCCAAACTCTCGCTACTACCTGAGC TGCCCCATGGAATCCCGCCACGCCACCTACTCATGGCGCCACAAGGAGAACGTGGAGCAG AGCTGCGAACCTGGTCACCAGAGCCCCAACTGCATCCTGTTCATCGAGAACCTCACGGCG CAGCAGTACGGCCACTACTTCTGCGAGGCCCAGGAGGGCTCCTACTTCCGCGAGGCTCAG CACTGGCAGCTGCTGCCCGAGGACGGCATCATGGCCGAGCACCTGCTGGGTCATGCCTGT GCCCTGGCCGCCTCCCTCTGGCTGGGGGTGCTGCCCACACTCACTCTTGGCTTGCTGGTC CAC |
Restriction Sites | Please inquire |
ACCN | NM_001146030 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146030.1, NP_001139502.1 |
RefSeq Size | 3246 bp |
RefSeq ORF | 1506 bp |
Locus ID | 8482 |
UniProt ID | O75326 |
Cytogenetics | 15q24.1 |
Protein Pathways | Axon guidance |
Gene Summary | This gene encodes a member of the semaphorin family of proteins. The encoded preproprotein is proteolytically processed to generate the mature glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. The encoded protein is found on activated lymphocytes and erythrocytes and may be involved in immunomodulatory and neuronal processes. The encoded protein carries the John Milton Hagen (JMH) blood group antigens. Mutations in this gene may be associated with reduced bone mineral density (BMD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter N-terminus and lacks a predicted signal peptide compared to isoform 1. Sequence Note: This RefSeq record represents the SEMA7A*001.1.1 allele. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228931 | SEMA7A (Myc-DDK-tagged)-Human semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A), transcript variant 3 |
USD 977.00 |
|
RC228931L3 | Lenti-ORF clone of SEMA7A (Myc-DDK-tagged)-Human semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A), transcript variant 3 |
USD 1,277.00 |
|
RC228931L4 | Lenti-ORF clone of SEMA7A (mGFP-tagged)-Human semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A), transcript variant 3 |
USD 1,277.00 |
|
RG228931 | SEMA7A (tGFP-tagged) - Human semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) (SEMA7A), transcript variant 3 |
USD 1,177.00 |
{0} Product Review(s)
Be the first one to submit a review