Semaphorin 7a (SEMA7A) (NM_001146030) Human Untagged Clone

CAT#: SC327566

SEMA7A (untagged)-Human semaphorin 7A GPI membrane anchor (John Milton Hagen blood group) (SEMA7A) transcript variant 3


  "NM_001146030" in other vectors (4)

Reconstitution Protocol

USD 747.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-SEMA7A Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SEMA7A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SEMA7A
Synonyms CD108; CDw108; H-SEMA-K1; H-Sema-L; JMH; SEMAK1; SEMAL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001146030, the custom clone sequence may differ by one or more nucleotides
ATGAGAGGCTACGCCCCCTTCAGCCCGGACGAGAACTCCCTGGTTCTGTTTGAAGGGGAC
GAGGTGTATTCCACCATCCGGAAGCAGGAATACAATGGGAAGATCCCTCGGTTCCGCCGC
ATCCGGGGCGAGAGTGAGCTGTACACCAGTGATACTGTCATGCAGAACCCACAGTTCATC
AAAGCCACCATCGTGCACCAAGACCAGGCTTACGATGACAAGATCTACTACTTCTTCCGA
GAGGACAATCCTGACAAGAATCCTGAGGCTCCTCTCAATGTGTCCCGTGTGGCCCAGTTG
TGCAGGGGGGACCAGGGTGGGGAAAGTTCACTGTCAGTCTCCAAGTGGAACACTTTTCTG
AAAGCCATGCTGGTATGCAGTGATGCTGCCACCAACAAGAACTTCAACAGGCTGCAAGAC
GTCTTCCTGCTCCCTGACCCCAGCGGCCAGTGGAGGGACACCAGGGTCTATGGTGTTTTC
TCCAACCCCTGGAACTACTCAGCCGTCTGTGTGTATTCCCTCGGTGACATTGACAAGGTC
TTCCGTACCTCCTCACTCAAGGGCTACCACTCAAGCCTTCCCAACCCGCGGCCTGGCAAG
TGCCTCCCAGACCAGCAGCCGATACCCACAGAGACCTTCCAGGTGGCTGACCGTCACCCA
GAGGTGGCGCAGAGGGTGGAGCCCATGGGGCCTCTGAAGACGCCATTGTTCCACTCTAAA
TACCACTACCAGAAAGTGGCCGTCCACCGCATGCAAGCCAGCCACGGGGAGACCTTTCAT
GTGCTTTACCTAACTACAGACAGGGGCACTATCCACAAGGTGGTGGAACCGGGGGAGCAG
GAGCACAGCTTCGCCTTCAACATCATGGAGATCCAGCCCTTCCGCCGCGCGGCTGCCATC
CAGACCATGTCGCTGGATGCTGAGCGGAGGAAGCTGTATGTGAGCTCCCAGTGGGAGGTG
AGCCAGGTGCCCCTGGACCTGTGTGAGGTCTATGGCGGGGGCTGCCACGGTTGCCTCATG
TCCCGAGACCCCTACTGCGGCTGGGACCAAGGCCGCTGCATCTCCATCTACAGCTCCGAA
CGGTCAGTGCTGCAATCCATTAATCCAGCCGAGCCACACAAGGAGTGTCCCAACCCCAAA
CCAGACAAGGCCCCACTGCAGAAGGTTTCCCTGGCCCCAAACTCTCGCTACTACCTGAGC
TGCCCCATGGAATCCCGCCACGCCACCTACTCATGGCGCCACAAGGAGAACGTGGAGCAG
AGCTGCGAACCTGGTCACCAGAGCCCCAACTGCATCCTGTTCATCGAGAACCTCACGGCG
CAGCAGTACGGCCACTACTTCTGCGAGGCCCAGGAGGGCTCCTACTTCCGCGAGGCTCAG
CACTGGCAGCTGCTGCCCGAGGACGGCATCATGGCCGAGCACCTGCTGGGTCATGCCTGT
GCCCTGGCCGCCTCCCTCTGGCTGGGGGTGCTGCCCACACTCACTCTTGGCTTGCTGGTC
CAC
Restriction Sites Please inquire     
ACCN NM_001146030
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001146030.1, NP_001139502.1
RefSeq Size 3246 bp
RefSeq ORF 1506 bp
Locus ID 8482
UniProt ID O75326
Cytogenetics 15q24.1
Protein Pathways Axon guidance
Gene Summary This gene encodes a member of the semaphorin family of proteins. The encoded preproprotein is proteolytically processed to generate the mature glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. The encoded protein is found on activated lymphocytes and erythrocytes and may be involved in immunomodulatory and neuronal processes. The encoded protein carries the John Milton Hagen (JMH) blood group antigens. Mutations in this gene may be associated with reduced bone mineral density (BMD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter N-terminus and lacks a predicted signal peptide compared to isoform 1. Sequence Note: This RefSeq record represents the SEMA7A*001.1.1 allele.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.