AADACL1 (NCEH1) (NM_001146277) Human Untagged Clone

CAT#: SC327431

NCEH1 (untagged)-Human neutral cholesterol ester hydrolase 1 (NCEH1) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NCEH1
• Synonyms: AADACL1; NCEH
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001146277, the custom clone sequence may differ by one or more nucleotides
  ATGGCTGAGGAATTGAATGCTGTCATTGTTTCCATTGAATACAGGCTAGTTCCAAAGGTT
  TATTTTCCTGAGCAAATTCATGATGTTGTACGGGCCACAAAGTATTTCCTGAAGCCAGAA
  GTCTTACAGAAGTATATGGTTGATCCAGGCAGAATTTGCATTTCTGGTGACAGTGCTGGT
  GGAAATCTGGCTGCTGCCCTTGGACAACAGTTTACTCAAGATGCCAGCCTAAAAAATAAG
  CTCAAACTACAAGCTTTAATTTATCCAGTTCTTCAAGCTTTAGATTTTAACACACCATCT
  TATCAGCAAAATGTGAACACCCCAATCCTGCCCCGCTATGTCATGGTGAAGTATTGGGTG
  GACTACTTCAAAGGCAACTATGACTTTGTGCAGGCAATGATCGTTAACAATCACACTTCA
  CTTGATGTGGAAGAGGCTGCTGCTGTCAGGGCCCGTCTAAACTGGACATCCCTCTTGCCT
  GCATCCTTCACAAAGAACTACAAGCCTGTTGTACAGACCACAGGCAATGCCAGGATTGTC
  CAGGAGCTTCCTCAGTTGCTGGATGCCCGCTCCGCCCCACTCATTGCAGACCAGGCAGTG
  CTGCAGCTCCTCCCAAAGACCTACATTCTGACGTGTGAGCATGATGTCCTCAGAGACGAT
  GGCATCATGTATGCCAAGCGTTTGGAGAGTGCCGGTGTGGAGGTGACCCTGGATCACTTT
  GAGGATGGCTTTCACGGATGTATGATTTTCACTAGCTGGCCCACCAACTTCTCAGTGGGA
  ATCCGGACTAGGAATAGTTACATCAAGTGGCTAGATCAAAACCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001146277
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001146277.1, NP_001139749.1
• RefSeq Size: 4284 bp
• RefSeq ORF: 828 bp
• Locus ID: 57552
• UniProt ID: Q6PIU2
• Cytogenetics: 3q26.31
• Protein Families: Transmembrane
• Gene Summary: Hydrolyzes 2-acetyl monoalkylglycerol ether, the penultimate precursor of the pathway for de novo synthesis of platelet-activating factor. May be responsible for cholesterol ester hydrolysis in macrophages, thereby contributing to the development of atherosclerosis. Also involved in organ detoxification by hydrolyzing exogenous organophosphorus compounds. May contribute to cancer pathogenesis by promoting tumor cell migration.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (c) is shorter than isoform a. Variants 3 and 4 encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.