MEF2A (NM_001130928) Human Untagged Clone
CAT#: SC325086
MEF2A (untagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 4
"NM_001130928" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MEF2A |
Synonyms | ADCAD1; mef2; RSRFC4; RSRFC9 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001130928, the custom clone sequence may differ by one or more nucleotides
ATGGGGCGGAAGAAAATACAAATCACACGCATAATGGATGAAAGGAACCGACAGACTTTA AGAAAGAAAGGCCTTAATGGTTGTGAGAGCCCTGATGCTGACGATTACTTTGAGCACAGT CCACTCTCGGAGGACAGATTCAGCAAACTAAATGAAGATAGTGATTTTATTTTCAAACGA GGCCCTCCTGGTCTGCCACCTCAGAACTTTTCAATGTCTGTCACAGTTCCAGTGACCAGC CCCAATGCTTTGTCCTACACTAACCCAGGGAGTTCACTGGTGTCCCCATCTTTGGCAGCC AGCTCAACGTTAACAGATTCAAGCATGCTCTCTCCACCTCAAACCACATTACATAGAAAT GTGTCTCCTGGAGCTCCTCAGAGACCACCAAGTACTGGCAATGCAGGTGGGATGTTGAGC ACTACAGACCTCACAGTGCCAAATGGAGCTGGAAGCAGTCCAGTGGGGAATGGATTTGTA AACTCAAGAGCTTCTCCAAATTTGATTGGAGCTACTGGTGCAAATAGCTTAGGCAAAGTC ATGCCTACAAAGTCTCCCCCTCCACCAGGTGGTGGTAATCTTGGAATGAACAGTAGGAAA CCAGATCTTCGAGTTGTCATCCCCCCTTCAAGCAAGGGCATGATGCCTCCACTAAATACC CAAAGGATCAGTAGTTCTCAAGCCACTCAACCTCTTGCTACCCCAGTCGTGTCTGTGACA ACCCCAAGCTTGCCTCCGCAAGGACTTGTGTACTCAGCAATGCCGACTGCCTACAACACT GATTATTCACTGACCAGCGCTGACCTGTCAGCCCTTCAAGGCTTCAACTCGCCAGGAATG CTGTCGCTGGGACAGGTGTCGGCCTGGCAGCAGCACCACCTAGGACAAGCAGCCCTCAGC TCTCTTGTTGCTGGAGGGCAGTTATCTCAGGGTTCCAATTTATCCATTAATACCAACCAA AACATCAGCATCAAGTCCGAACCGATTTCACCTCCTCGGGATCGTATGACCCCATCGGGC TTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCACCACCGCAGCCCCAG CCACAACCCCCGCAGCCCCAGCCCCGACAGGAAATGGGGCGCTCCCCTGTGGACAGTCTG AGCAGCTCTAGTAGCTCCTATGATGGCAGTGATCGGGAGGATCCACGGGGCGACTTCCAT TCTCCAATTGTGCTTGGCCGACCCCCAAACACTGAGGACAGAGAAAGCCCTTCTGTAAAG CGAATGAGGATGGACGCGTGGGTGACC |
Restriction Sites | Please inquire |
ACCN | NM_001130928 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001130928.1, NP_001124400.1 |
RefSeq Size | 5100 bp |
RefSeq ORF | 1290 bp |
Locus ID | 4205 |
UniProt ID | Q02078 |
Cytogenetics | 15q26.3 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010] Transcript Variant: This variant (4) lacks multiple, in-frame coding exons, compared to transcript variant 6. These differences result in a shorter isoform (4), compared to isoform 5. The 5' UTR of this transcript variant is undefined. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225702 | MEF2A (Myc-DDK-tagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 4 |
USD 503.00 |
|
RC225702L3 | Lenti-ORF clone of MEF2A (Myc-DDK-tagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 4 |
USD 803.00 |
|
RC225702L4 | Lenti-ORF clone of MEF2A (mGFP-tagged)-Human myocyte enhancer factor 2A (MEF2A), transcript variant 4 |
USD 803.00 |
|
RG225702 | MEF2A (tGFP-tagged) - Human myocyte enhancer factor 2A (MEF2A), transcript variant 4 |
USD 703.00 |
{0} Product Review(s)
Be the first one to submit a review