Emi1 (FBXO5) (NM_001142522) Human Untagged Clone
CAT#: SC325052
FBXO5 (untagged)-Human F-box protein 5 (FBXO5), transcript variant 2
"NM_001142522" in other vectors (4)
Product Images
![](https://origeneresource2.s3.us-east-2.amazonaws.com/cmsstatics/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FBXO5 |
Synonyms | EMI1; FBX5; Fbxo31 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142522, the custom clone sequence may differ by one or more nucleotides
ATGAAGTGTGATTTTAATTGTAACCATGTTCATTCCGGACTTAAACTGGTAAAACCTGAT GACATTGGAAGACTAGTTTCCTACACCCCTGCATATTTGGAAGGTTCCTGTAAAGACTGC ATTAAAGACTATGAAAGGCTGTCATGTATTGGGTCACCGATTGTGAGCCCTAGGATTGTA CAACTTGAAACTGAAAGCAAGCGCTTGCATAACAAGGAAAATCAACATGTGCAACAGACA CTTAATAGTACAAATGAAATAGAAGCACTAGAGACCAGTAGACTTTATGAAGACAGTGGC TATTCCTCATTTTCTCTACAAAGTGGCCTCAGTGAACATGAAGAAGGTAGCCTCCTGGAG GAGAATTTCGGTGACAGTCTACAATCCTGCCTGCTACAAATACAAAGCCCAGACCAATAT CCCAACAAAAACTTGCTGCCAGTTCTTCATTTTGAAAAAGTGGTTTGTTCAACATTAAAA AAGAATGCAAAACGAAATCCTAAAGTAGATCGGGAGATGCTGAAGGAAATTATAGCCAGA GGAAATTTTAGACTGCAGAATATAATTGGCAGAAAAATGGGCCTAGAATGTGTAGATATT CTCAGCGAACTCTTTCGAAGGGGACTCAGACATGTCTTAGCAACTATTTTAGCACAACTC AGTGACATGGACTTAATCAATGTGTCTAAAGTGAGCACAACTTGGAAGAAGATCCTAGAA GATGATAAGGGGGCATTCCAGTTGTACAGTAAAGCAATACAAAGAGTTACCGAAAACAAC AATAAATTTTCACCTCATGCTTCAACCAGAGAATATGTTATGTTCAGAACCCCACTGGCT TCTGTTCAGAAATCAGCAGCCCAGACTTCTCTCAAAAAAGATGCTCAAACCAAGTTATCC AATCAAGGTGATCAGAAAGGTTCTACTTATAGTCGACACAATGAATTCTCTGAGGTTGCC AAGACATTGAAAAAGAACGAAAGCCTCAAAGCCTGTATTCGCTGTAATTCACCTGCAAAA TATGATTGCTATTTACAACGGGCAACCTGCAAACGAGAAGGCTGTGGATTTGATTATTGT ACGAAGTGTCTCTGTAATTATCATACTACTAAAGACTGTTCAGATGGCAAGCTCCTCAAA GCCAGTTGTAAAATAGGTCCCCTGCCTGGTACAAAGAAAAGCAAAAAGAATTTACGAAGA TTG |
Restriction Sites | Please inquire |
ACCN | NM_001142522 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001142522.1, NP_001135994.1 |
RefSeq Size | 2269 bp |
RefSeq ORF | 1206 bp |
Locus ID | 26271 |
UniProt ID | Q9UKT4 |
Cytogenetics | 6q25.2 |
Protein Families | Druggable Genome |
Protein Pathways | Oocyte meiosis |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is similar to xenopus early mitotic inhibitor-1 (Emi1), which is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Dec 2008] Transcript Variant: This variant (2) contains an alternate exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform b has a shorter N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227496 | FBXO5 (Myc-DDK-tagged)-Human F-box protein 5 (FBXO5), transcript variant 2 |
USD 503.00 |
|
RC227496L3 | Lenti-ORF clone of FBXO5 (Myc-DDK-tagged)-Human F-box protein 5 (FBXO5), transcript variant 2 |
USD 803.00 |
|
RC227496L4 | Lenti-ORF clone of FBXO5 (mGFP-tagged)-Human F-box protein 5 (FBXO5), transcript variant 2 |
USD 803.00 |
|
RG227496 | FBXO5 (tGFP-tagged) - Human F-box protein 5 (FBXO5), transcript variant 2 |
USD 703.00 |
{0} Product Review(s)
Be the first one to submit a review