ELK1 (NM_001114123) Human Untagged Clone
CAT#: SC318874
ELK1 (untagged)-Human ELK1, member of ETS oncogene family (ELK1), transcript variant 1
"NM_001114123" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ELK1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_005229, the custom clone sequence may differ by one or more nucleotides
ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAATGGCCACATCA TCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAGGAGGTGGCCCGGCTGTGGGG GCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTCAGCCGGGCCTTGCGGTACTACTATGACAAG AACATCATCCGCAAGGTGAGCGGCCAGAAGTTCGTCTACAAGTTTGTGTCCTACCCTGAGGTCGCAGGGT GCTCCACTGAGGACTGCCCGCCCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGC TGCTATACATGCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCA GGCCCAGGCGGTTTGGCACGCAGCAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCCACCTTCACCA TCCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTGCTCCCCAGTGCAGCTCCTGC AGGGGCAGCAGCGCCCCCCTCGGGGAGCAGGAGCACCAGTCCAAGCCCCTTGGAGGCCTGTCTGGAGGCT GAAGAGGCCGGCTTGCCTCTGCAGGTCATCCTGACCCCGCCCGAGGCCCCAAACCTGAAATCGGAAGAGC TTAATGTGGAGCCGGGTTTGGGCCGGGCTTTGCCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTT GGAAGTTGCGGGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAAGTCCCTCCACAGGAG GGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATGGACACCGCAGGGCAGGCGGGCGGCCATGCGGCTTCCA GCCCTGAGATCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAGCTTCCACTCAGCCCGAGCCT GCTAGGTGGGCCGGGACCCGAACGGACCCCAGGATCGGGAAGTGGCTCCGGCCTCCAGGCTCCGGGGCCG GCGCTGACCCCATCCCTGCTTCCTACGCATACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTC CTAGCATTCACTTCTGGAGCACCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGTT TCCATCCAGTGGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGACCCCCGTGGTG CTCTCCCCAGGGCCCCAGAAGCCATGA |
Restriction Sites | NotI-NotI |
ACCN | NM_001114123 |
Insert Size | 2800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001114123.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001114123.1, NP_001107595.1 |
RefSeq Size | 2934 bp |
RefSeq ORF | 2934 bp |
Locus ID | 2002 |
UniProt ID | P19419 |
Cytogenetics | Xp11.23 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Endometrial cancer, ErbB signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Prion diseases |
Gene Summary | This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (1, also known as 5'UTR long or 5'UTRL) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode isoform a. Delayed translational reinitiation from an alternative downstream start codon, AUG sElk-1, can also result in a shorter isoform (sELK-1), as described in PMID:22354998. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225701 | ELK1 (Myc-DDK-tagged)-Human ELK1, member of ETS oncogene family (ELK1), transcript variant 1 |
USD 686.00 |
|
RC225701L3 | Lenti-ORF clone of ELK1 (Myc-DDK-tagged)-Human ELK1, member of ETS oncogene family (ELK1), transcript variant 1 |
USD 986.00 |
|
RC225701L4 | Lenti-ORF clone of ELK1 (mGFP-tagged)-Human ELK1, member of ETS oncogene family (ELK1), transcript variant 1 |
USD 986.00 |
|
RG225701 | ELK1 (tGFP-tagged) - Human ELK1, member of ETS oncogene family (ELK1), transcript variant 1 |
USD 886.00 |
{0} Product Review(s)
Be the first one to submit a review