XAGE1 (XAGE1E) (NM_001097605) Human Untagged Clone

CAT#: SC316092

XAGE1E (untagged)-Human X antigen family, member 1E (XAGE1E), transcript variant d

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: XAGE1B
• Synonyms: CT12.1; CT12.1b; CT12.1C; CT12.1D; CT12.1E; CTP9; GAGED2; XAGE-1; XAGE1; XAGE1C; XAGE1D; XAGE1E
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001097605, the custom clone sequence may differ by one or more nucleotides
  ATGGAGAGCCCCAAAAAGAAGAACCAGCAGCTGAAAGTCGGGATCCTACACCTGGGCAGC
  AGACAGAAGAAGATCAGGATACAGCTGAGATCCCAGGTGCTGGGAAGGGAAATGCGCGAC
  ATGGAAGGTGATCTGCAAGAGCTGCATCAGTCAAACACCGGGGATAAATCTGGATTTGGG
  TTCCGGCGTCAAGGTGAAGATAATACC
  
• Restriction Sites: Please inquire
• ACCN: NM_001097605
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001097605.1, NP_001091074.1
• RefSeq Size: 396 bp
• RefSeq ORF: 210 bp
• Locus ID: 653067
• UniProt ID: Q9HD64
• Cytogenetics: Xp11.22
• Gene Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (d, also known as XAGE-1d) starts at a downstream transcription start site, and uses an alternate splice site in an internal exon that causes a frameshift in the 3' coding region, compared to variant a. The encoded isoform (d) has a distinct and shorter C-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.