Insulin Receptor(INSR) (NM_001079817) Human Untagged Clone

CAT#: SC315880

INSR (untagged)-Human insulin receptor (INSR), transcript variant 2

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Insulin Receptor(INSR) (NM_001079817) Human Untagged Clone
Symbol INSR
Synonyms CD220; HHF5
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001079817 edited
GGCACGAGGCGGAGCTCCGGGCCCCGAGATCCTGGGACGGGGCCCGGGCCGCAGCGGCCG
GGGGGTCGGGGCCACCACCGCAAGGGCCTCCGCTCAGTATTTGTAGCTGGCGAAGCCGCG
CGCGCCCTTCCCGGGGCTGCCTCTGGGCCCTCCCCGGCAGGGGGGCTGCGGCCCGCGGGT
CGCGGGCGTGGAAGAGAAGGACGCGCGGCCCCCAGCGCCTCTTGGGTGGCCGCCTCGGAG
CATGACCCCCGCGGGCCAGCGCCGCGCGCTCTGATCCGAGGAGACCCCGCGCTCCCGCAG
CCATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCCG
CGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAGAGGTGTGTCCCGGCATGGATA
TCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGGACACT
TGCAGATACTCTTGATGTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGTTTCCCCA
AACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCGAGAGCCTGA
AGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTTTAACTACGCGC
TGGTCATCTTCGAGATGGTTCACCTCAAGGAACTCGGCCTCTACAACCTGATGAACATCA
CCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACTTGGCCACTATCGACT
GGTCCCGTATCCTGGATTCCGTGGAGGATAATTACATCGTGTTGAACAAAGATGACAACG
AGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACCAACTGCCCCGCCACCG
TCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCATAGTCACTGCCAGAAAGTTTGCC
CGACCATCTGTAAGTCACACGGCTGCACCGCCGAAGGCCTCTGTTGCCACAGCGAGTGCC
TGGGCAACTGTTCTCAGCCCGACGACCCCACCAAGTGCGTGGCCTGCCGCAACTTCTACC
TGGACGGCAGGTGTGTGGAGACCTGCCCGCCCCCGTACTACCACTTCCAGGACTGGCGCT
GTGTGAACTTCAGCTTCTGCCAGGACCTGCACCACAAATGCAAGAACTCGCGGAGGCAGG
GCTGCCACCAGTACGTCATTCACAACAACAAGTGCATCCCTGAGTGTCCCTCCGGGTACA
CGATGAATTCCAGCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCC
ACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGAGCTCCGAGGAT
GCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTG
AGCTAGAAGCCAACCTCGGCCTCATTGAAGAAATTTCAGGGTATCTAAAAATCCGCCGAT
CCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCT
TGGAAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGG
ACTGGAGCAAACACAACCTCACCATCACTCAGGGGAAACTCTTCTTCCACTATAACCCCA
AACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGG
AGAGAAACGACATTGCCCTGAAGACCAATGGGGACCAGGCATCCTGTGAAAATGAGTTAC
TTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGCCGTACT
GGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGCCCCTTATC
AGAATGTGACGGAGTTCGACGGGCAGGATGCGTGTGGTTCCAACAGTTGGACGGTGGTAG
ACATTGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAACCACCCAGGGTGGCTGA
TGCGGGGTCTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAGACCCTGGTCACCTTTT
CGGATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTATGTCCAGACAGATGCCA
CCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCATCATCCCAGATTATTC
TGAAGTGGAAACCACCCTCCGACCCCAATGGCAACATCACCCACTACCTGGTTTTCTGGG
AGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGCCTCAAAGGGCTGAAGC
TGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAACCAGA
GTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCTGTCCAAAGACAGACTCTCAGATCC
TGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGCACAACGTGG
TTTTCGTCCCCAGAAAAACCTCTTCAGGCACTGGTGCCGAGGACCCTAGGCCATCTCGGA
AACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCACGGTGGCAGCTT
TCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAGCACAGGCCTTTTGAGA
AGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACACTTCACGGGCTATCGCA
TCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTGTGGCAGCCTACG
TCAGTGCGAGGACCATGCCTGAAGCCAAGGCTGATGACATTGTTGGCCCTGTGACGCATG
AAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAGGAGCCCAATGGTC
TGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGGAGCTGCATCTCTGCG
TCTCCCGCAAGCACTTCGCTCTGGAACGGGGCTGCAGGCTGCGTGGGCTGTCACCGGGGA
ACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGCTCTTGGACGGAACCCA
CCTATTTCTACGTGACAGACTATTTAGACGTCCCGTCAAATATTGCAAAAATTATCATCG
GCCCCCTCATCTTTGTCTTTCTCTTCAGTGTTGTGATTGGAAGTATTTATCTATTCCTGA
GAAAGAGGCAGCCAGATGGGCCGCTGGGACCGCTTTACGCTTCTTCAAACCCTGAGTATC
TCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCGGACGAGTGGGAGGTGTCTC
GAGAGAAGATCACCCTCCTTCGAGAGCTGGGGCAGGGCTCCTTCGGCATGGTGTATGAGG
GCAATGCCAGGGACATCATCAAGGGTGAGGCAGAGACCCGCGTGGCGGTGAAGACGGTCA
ACGAGTCAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAGGCCTCGGTCATGAAGG
GCTTCACCTGCCATCACGTGGTGCGCCTCCTGGGAGTGGTGTCCAAGGGCCAGCCCACGC
TGGTGGTGATGGAGCTGATGGCTCACGGAGACCTGAAGAGCTACCTCCGTTCTCTGCGGC
CAGAGGCTGAGAATAATCCTGGCCGCCCTCCCCCTACCCTTCAAGAGATGATTCAGATGG
CGGCAGAGATTGCTGACGGGATGGCCTACCTGAACGCCAAGAAGTTTGTGCATCGGGACC
TGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAAAATTGGAGACTTTGGAA
TGACCAGAGACATCTATGAAACGGATTACTACCGGAAAGGGGGCAAGGGTCTGCTCCCTG
TACGGTGGATGGCACCGGAGTCCCTGAAGGATGGGGTCTTCACCACTTCTTCTGACATGT
GGTCCTTTGGCGTGGTCCTTTGGGAAATCACCAGCTTGGCAGAACAGCCTTACCAAGGCC
TGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGGAGGGTATCTGGATCAACCCGACA
ACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGTGCTGGCAATTCAACCCCAAGATGA
GGCCAACCTTCCTGGAGATTGTCAACCTGCTCAAGGACGACCTGCACCCCAGCTTTCCAG
AGGTGTCGTTCTTCCACAGCGAGGAGAACAAGGCTCCCGAGAGTGAGGAGCTGGAGATGG
AGTTTGAGGACATGGAGAATGTGCCCCTGGACCGTTCCTCGCACTGTCAGAGGGAGGAGG
CGGGGGGCCGGGATGGAGGGTCCTCGCTGGGTTTCAAGCGGAGCTACGAGGAACACATCC
CTTACACACACATGAACGGAGGCAAGAAAAACGGGCGGATTCTGACCTTGCCTCGGTCCA
ATCCTTCCTAACAGTGCCTACCGTGGCGGGGGCGGGCAGGGGTTCCCATTTTCGCTTTCC
TCTGGTTTGAAAGCCTCTGGAAAACTCAGGATTCTCACGACTCTACCATGTCCAATGGAG
TTCAGAGATCGTTCCTATACATTTCTGTTCATCTTAAGGTGGACTCGTTTGGTTACCAAT
TTAACTAGTCCTGCAGAGGATTTAACTGTGAACCTGGAGGGCAAGGGGTTTCCACAGTTG
CTGCTCCTTTGGGGCAACGACGGTTTCAAACCAGGATTTTGTGTTTTTTCGTTCCCCCCA
CCCGCCCCCAGCAGATGGAAAGAAAGCACCTGTTTTTACAAATTCTTTTTTTTTTTTTTT
TTTTTTGCTGGTGTCTGAGCTTCAGTATAAAAGACAAAACTTCCTGTTTGTGGAACAAAA
GTTCGAAAGAAAAAACAAAACAAAAACACCCAGCCCTGTTCCAGGAGAATTTCAAGTTTT
ACAGGTTGAGCTTCAAGATGGTTTTTTTGGTTTTTTTTTTTTCTCTCATCCAGGCTGAAG
GATTTTTTTTTTCTTTACAAAATGAGTTCCTCAAATTGACCAATAGCTGCTGCTTTCATA
TTTTGGATAAGGGTCTGTGGTCCCGGCGTGTGCTCACGTGTGTATGCACGTGTGTGTGTC
CATTAGACACGGCTGATGTGTGTGCAAAGTATCCATGCGGAGTTGATGCTTTGGGAATTG
GCTCATGAAGGTTCTTCTCAAGGGTGCGAGCTCATCCCCCTCTCTCCTTCCTTCTTATTG
ACTGGGAGACTGTGCTCTCGACAGATTCTTCTTGTGTCAGAAGTCTAGCCTCAGGTTTCT
ACCCTCCCTTCACATTGGTGGCCAAGGGAGGAGCATTTCATTTGGAGTGATTATGAATCT
TTTCAAGACCAAACCAAGCTAGGACATTAAAAAAAAAAAAAGAAAAAGAAAGAAAAAACA
AAATGGAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000208 unedited
TCACTATATGGCGGCCGCGAATTCGGCACGAGGCGGAGCTCCGGGCCCCGAGATCCTGGG
ACGGGGCCCTGGCCGCAGCGGCCGGGGGGTCGGGGCCACCACCGCAAGGGCCTCCGCTCA
GTATTTGTAGCTGGCGAAGCCGCGCGCGCCCTTCCCGGGGCTGCCTCTGGGCCCTCCCCG
GCAGGGGGGCTGCGGCCCGCGGGTCGCGGGCGTGGAAGAGAAGGACGCGCGGCCCCCAGC
GCCTCTTGGGTGGCCGCCTCGGAGCATGACCCCCGCGGGCCAGCGCCGCGCGCTCTGATC
CGAGGAGACCCCGCGCTCCCGCAGCCATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCG
CGCCGCTGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCG
GAGAGGTGTGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGA
ATTGCTCTGTCATCGAAGGACACTTGCAGATACTCTTGATGTTCAAAACGAGGCCCGAAG
ATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCC
CGGTCTATGGGCTCGAGAGCCTGAAAGACCTGTTCCCCAACCTCACGGGCATCCCGGGAT
CACGACTGTTCTTTAACTACGCCCTGGTCATCTTTCAGATGGTTCACCTCAAGGAACTCG
G
Tag Tag Free
ACCN NM_001079817
ORF Size 4113 bp
Insert Size 5000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001079817.1, NP_001073285
RefSeq Size 9023
Locus ID 3643
Cytogenetics 19p13.2
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways Adherens junction, Insulin signaling pathway, Type II diabetes mellitus
Gene Summary This gene encodes a member of the receptor tyrosine kinase family of proteins. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that form a heterotetrameric receptor. Binding of insulin or other ligands to this receptor activates the insulin signaling pathway, which regulates glucose uptake and release, as well as the synthesis and storage of carbohydrates, lipids and protein. Mutations in this gene underlie the inherited severe insulin resistance syndromes including type A insulin resistance syndrome, Donohue syndrome and Rabson-Mendenhall syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (Short) has the same N- and C-termini but is shorter compared to isoform Long.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations