Caspase 10 (CASP10) (NM_032974) Human Untagged Clone

CAT#: SC313837

CASP10 (untagged)-Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 2


  "NM_032974" in other vectors (4)

Reconstitution Protocol

SC313837 is the updated version of SC126552.

USD 535.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-CASP10 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CASP10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CASP10
Synonyms ALPS2; FLICE-2; FLICE2; MCH4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_032974, the custom clone sequence may differ by one or more nucleotides
ATGAAATCTCAAGGTCAACATTGGTATTCCAGTTCAGATAAAAACTGTAAAGTGAGCTTT
CGTGAGAAGCTTCTGATTATTGATTCAAACCTGGGGGTCCAAGATGTGGAGAACCTCAAG
TTTCTCTGCATAGGATTGGTCCCCAACAAGAAGCTGGAGAAGTCCAGCTCAGCCTCAGAT
GTTTTTGAACATCTCTTGGCAGAGGATCTGCTGAGTGAGGAAGACCCTTTCTTCCTGGCA
GAACTCCTCTATATCATACGGCAGAAGAAGCTGCTGCAGCACCTCAACTGTACCAAAGAG
GAAGTGGAGCGACTGCTGCCCACCCGACAAAGGGTTTCTCTGTTTAGAAACCTGCTCTAC
GAACTGTCAGAAGGCATTGACTCAGAGAACTTAAAGGACATGATCTTCCTTCTGAAAGAC
TCGCTTCCCAAAACTGAAATGACCTCCCTAAGTTTCCTGGCATTTCTAGAGAAACAAGGT
AAAATAGATGAAGATAATCTGACATGCCTGGAGGACCTCTGCAAAACAGTTGTACCTAAA
CTTTTGAGAAACATAGAGAAATACAAAAGAGAGAAAGCTATCCAGATAGTGACACCTCCT
GTAGACAAGGAAGCCGAGTCGTATCAAGGAGAGGAAGAACTAGTTTCCCAAACAGATGTT
AAGACATTCTTGGAAGCCTTACCGCAGGAGTCCTGGCAAAATAAGCATGCAGGTAGTAAT
GGTAACAGAGCCACAAATGGTGCACCAAGCCTGGTCTCCAGGGGGATGCAAGGAGCATCT
GCTAACACTCTAAACTCTGAAACCAGCACAAAGAGGGCAGCTGTGTACAGGATGAATCGG
AACCACAGAGGCCTCTGTGTCATTGTCAACAACCACAGCTTTACCTCCCTGAAGGACAGA
CAAGGAACCCATAAAGATGCTGAGATCCTGAGTCATGTGTTCCAGTGGCTTGGGTTCACA
GTGCATATACACAATAATGTGACGAAAGTGGAAATGGAGATGGTCCTGCAGAAGCAGAAG
TGCAATCCAGCCCATGCCGACGGGGACTGCTTCGTGTTCTGTATTCTGACCCATGGGAGA
TTTGGAGCTGTCTACTCTTCGGATGAGGCCCTCATTCCCATTCGGGAGATCATGTCTCAC
TTCACAGCCCTGCAGTGCCCTAGACTGGCTGAAAAACCTAAACTCTTTTTCATCCAGGCC
TGCCAAGGTGAAGAGATACAGCCTTCCGTATCCATCGAAGCAGATGCTCTGAACCCTGAG
CAGGCACCCACTTCCCTGCAGGACAGTATTCCTGCCGAGGCTGACTTCCTACTTGGTCTG
GCCACTGTCCCAGGCTATGTATCCTTTCGGCATGTGGAGGAAGGCAGCTGGTATATTCAG
TCTCTGTGTAATCATCTGAAGAAATTGGTCCCAAGGATGCTGAAATTTCTGGAAAAGACA
ATGGAAATCAGGGGCAGGAAGAGAACAGTGTGGGGTGCTAAACAGATCTCAGCAACCTCC
CTGCCCACGGCCATCTCTGCGCAGACACCTCGACCCCCCATGCGCAGGTGGAGCAGCGTT
TCC
Restriction Sites Please inquire     
ACCN NM_032974
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032974.2, NP_116756.2
RefSeq Size 2054 bp
RefSeq ORF 1566 bp
Locus ID 843
UniProt ID Q92851
Cytogenetics 2q33.1
Protein Families Druggable Genome, Protease
Protein Pathways Apoptosis, RIG-I-like receptor signaling pathway
Gene Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (2) contains an alternate 3' terminal exon compared to variant 1, and encodes an isoform (2, also known as FLICE2 and caspase-10/b) that has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.