GOLPH2 (GOLM1) (AK074188) Human Untagged Clone

CAT#: SC312110

(untagged)-Human cDNA FLJ23608 fis, clone ADKA01790

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GOLM1
• Synonyms: bA379P1.3; C9orf155; GOLPH2; GP73; HEL46; PSEC0257
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for AK074188, the custom clone sequence may differ by one or more nucleotides
  ATGGAGGGCCCTGAGCGAGACCAGCTTGTCATCCCCGACGGACAGGAGGAGGAGCAGGAA
  GCTGCCGGGGAAGGTGGGTGTGAAGTTTCGGGGGCCGCTGTGGACTCCCTCCCACCAGAC
  ACCCAGCCCACCTCCATGTCCTTCCCAGCACCAACATATCACCCTGAATTTTACCAAACA
  GCAGTCCACAATTTGCCAATTCCTTTTCGTTTGAAGGTTTCTTATTCGTTATCAAGAGGG
  AGGCAGGAAGGAAGAGCAGCATATGCTCTAGAACTCGAGGTTTTAGATGCAATATTGGCA
  GGGAGTCGAGGGGACCTTGCAAGTGGGTGGCCTGCAGATGGGTGCTTAGCATCAAGTGGA
  CGCCCCCTCCTGGCAGGCAGGCCACATGCCCCATTTTTGTATGTCCACCGTCGTGCAGTG
  TCTGGTGCCATT
  
• Restriction Sites: Please inquire
• ACCN: AK074188
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: AK074188.1, BAB85012.1
• RefSeq Size: 1618 bp
• RefSeq ORF: 435 bp
• Locus ID: 51280
• Cytogenetics: 9q21.33
• Protein Families: Transmembrane
• Gene Summary: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]