DEFB104B (NM_001040702) Human Untagged Clone
CAT#: SC311208
DEFB104B (untagged)-Human defensin, beta 104B (DEFB104B)
"NM_001040702" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DEFB104B |
Synonyms | BD-4; DEFB-4; hBD-4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001040702, the custom clone sequence may differ by one or more nucleotides
ATGCAGAGACTTGTGCTGCTATTAGCCATTTCTCTTCTACTCTATCAAGATCTTCCAGTG AGAAGCGAATTTGAATTGGACAGAATATGTGGTTATGGGACTGCCCGTTGCCGGAAGAAA TGTCGCAGCCAAGAATACAGAATTGGAAGATGTCCCAACACCTATGCATGCTGTTTGAGA AAATGGGATGAGAGCTTACTGAATCGTACAAAACCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001040702 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040702.1, NP_001035792.1 |
RefSeq Size | 281 bp |
RefSeq ORF | 219 bp |
Locus ID | 503618 |
UniProt ID | Q8WTQ1 |
Cytogenetics | 8p23.1 |
Gene Summary | Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 104, DEFB104A and DEFB104B, in head-to-head orientation. This gene, DEFB104B, represents the more telomeric copy. [provided by RefSeq, Oct 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224160 | DEFB104B (Myc-DDK-tagged)-Human defensin, beta 104B (DEFB104B) |
USD 150.00 |
|
RC224160L3 | Lenti-ORF clone of DEFB104B (Myc-DDK-tagged)-Human defensin, beta 104B (DEFB104B) |
USD 450.00 |
|
RC224160L4 | Lenti-ORF clone of DEFB104B (mGFP-tagged)-Human defensin, beta 104B (DEFB104B) |
USD 450.00 |
|
RG224160 | DEFB104B (tGFP-tagged) - Human defensin, beta 104B (DEFB104B) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review