CACNB4 (NM_000726) Human Untagged Clone
CAT#: SC311158
CACNB4 (untagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2
"NM_000726" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CACNB4 |
Synonyms | CAB4; CACNLB4; EA5; EIG9; EJM; EJM4; EJM6 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000726 edited
ATGTCCTCCTCCTCCTACGCCAAGAACGGGACCGCGGACGGGCCGCACTCCCCCACCTCG CAGGTGGCCCGAGGCACCACAACCCGGAGGAGCAGGTTGAAAAGATCCGATGGCAGCACC ACTTCGACCAGCTTCATCCTCAGACAGGGTTCAGCGGATTCCTACACAAGCAGGCCGTCT GACTCCGATGTCTCTTTGGAAGAGGACCGGGAAGCAATTCGACAGGAGAGAGAACAGCAA GCAGCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTAGCATTTGCCGTGAAGACAAAT GTGAGCTACTGCGGCGCCCTGGACGAGGATGTGCCTGTTCCAAGCACAGCTATCTCCTTT GATGCTAAAGACTTTCTACATATTAAAGAGAAATATAACAATGATTGGTGGATAGGAAGG CTGGTGAAAGAGGGCTGTGAAATTGGCTTCATTCCAAGTCCACTCAGATTGGAGAACATA CGGATCCAGCAAGAACAAAAAAGAGGACGTTTTCACGGAGGGAAATCAAGTGGAAATTCT TCTTCAAGTCTTGGAGAAATGGTATCTGGGACATTCCGAGCAACTCCCACATCAACAGCA AAACAGAAGCAAAAAGTGACGGAGCACATTCCTCCTTACGATGTTGTACCGTCAATGCGT CCGGTGGTGTTAGTGGGGCCGTCACTGAAAGGTTACGAGGTAACAGACATGATGCAGAAA GCCCTCTTTGATTTCCTGAAGCACAGGTTTGATGGGAGGATTTCAATAACGAGAGTGACA GCTGACATTTCTCTTGCTAAGAGGTCTGTCCTAAATAATCCCAGCAAGAGAGCAATAATT GAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGTGAAATTGAAAGAATCTTT GAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGACACCATCAATCACCCAGCA CAACTTATAAAGACTTCCTTAGCACCAATTATTGTTCATGTAAAAGTCTCATCTCCAAAG GTTTTACAGCGGTTGATTAAATCTAGAGGAAAGTCACAAAGTAAACACTTGAATGTTCAA CTGGTGGCAGCTGATAAACTTGCACAATGCCCCCCAGAAATGTTTGATGTTATATTGGAT GAAAATCAGCTTGAGGATGCATGTGAACATCTAGGGGAGTACCTGGAGGCGTACTGGCGT GCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATTTGGGCTCC ACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCAC AGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAA AATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCAT AGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGACTCATACCAGGACACTTAC AAACCCCATAGGAACCGAGGATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTT TGA |
Restriction Sites | Please inquire |
ACCN | NM_000726 |
Insert Size | 1600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000726.2, NP_000717.2 |
RefSeq Size | 3079 bp |
RefSeq ORF | 1563 bp |
Locus ID | 785 |
UniProt ID | O00305 |
Cytogenetics | 2q23.3 |
Domains | Ca_channel_B, SH3, GuKc |
Protein Families | Druggable Genome, Ion Channels: Other |
Protein Pathways | Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway |
Gene Summary | This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) encodes the longest isoform (b). This isoform has a b-type N-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210440 | CACNB4 (Myc-DDK-tagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2 |
USD 484.00 |
|
RC210440L1 | Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, Myc-DDK-tagged |
USD 784.00 |
|
RC210440L2 | Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, mGFP tagged |
USD 784.00 |
|
RC210440L3 | Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, Myc-DDK-tagged |
USD 784.00 |
|
RC210440L4 | Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, mGFP tagged |
USD 784.00 |
|
RG210440 | CACNB4 (tGFP-tagged) - Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2 |
USD 684.00 |
{0} Product Review(s)
Be the first one to submit a review