MS4A10 (NM_206893) Human Untagged Clone

CAT#: SC308304

MS4A10 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 10 (MS4A10)


  "NM_206893" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "MS4A10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MS4A10
Synonyms CD20L7; MS4A9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_206893 edited
AGAGCTGCAGTCCCAGGTCCTGGGCCAGGGCCCCCATCCAGCATCAATGAAAGCAGAAGC
CACAGTTATTCCCAGCCGTTGTGCTAGGGGGCTCCCATCATGGCAAGTCCTCAGCCCAGT
CCAGCCCTGGCAGACAAGTGCACCCCAGAACACGACCCAGCCCAAGCTCCTGGCTCCACA
CCAGCACGAGAAGTCCCAGAAGAAGAGCAGCCTTCTTAAGGAGCTGGGGGCCTTCCACAT
CACCATCGCTCTGCTGCACCTGGTCTTTGGGGGCTACCTGGCCTCTATAGTCAAGAACCT
TCACCTGGTGGTGCTGAAGTCTTGGTATCCATTCTGGGGGGCTGCCTCTTTTCTCATTTC
AGGGATCTTGGCGATAACAATGAAGACCTTTTCTAAAACTTACCTGAAGATGTTGTGCCT
GATGACAAACCTCATCAGCCTCTTTTGCGTGCTGTCTGGCCTCTTCGTCATCTCCAAGGA
TCTCTTTCTGGAGAGCCCATTTGAGTCCCCGATCTGGAGAATGTACCCCAACTCCACGGT
CCACATCCAGAGGCTGGAGCTGGCCTTGCTCTGCTTCACTGTCCTAGAGCTCTTCCTGCC
AGTGCCCACAGCTGTCACAGCCTGGAGAGGGGACTGCCCATCTGCAAAGAATGATGATGC
ATGCCTTGTTCCGAATACACCATTGCATCTCAAAGGCCTGCCGGTGGAGCCCCCGCCATC
CTACCAGAGTGTGATTCAAGGCGACGCACAACACAAGCAACATCAGAGGCTCAGAGAAGT
TAAGCAAGTTGCCCCGGACACATGGATAGTCACTGACGGAGCTGCGATCTGGACCCAGAC
TGCAAACTGAAGAGCCACTGCCTGACAATGCCCAAACTTGGTTGGAGCATAGCC
Restriction Sites Please inquire     
ACCN NM_206893
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_206893.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_206893.1, NP_996776.1
RefSeq Size 2287 bp
RefSeq ORF 804 bp
Locus ID 341116
UniProt ID Q96PG2
Cytogenetics 11q12.2
Protein Families Druggable Genome, Transmembrane
Gene Summary Most MS4A genes, including MS4A10, encode proteins with at least 4 potential transmembrane domains and N- and C-terminal cytoplasmic domains encoded by distinct exons.[supplied by OMIM, Apr 2004]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.