COPE (NM_199442) Human Untagged Clone

CAT#: SC307977

COPE (untagged)-Human coatomer protein complex, subunit epsilon (COPE), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COPE
• Synonyms: epsilon-COP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_199442, the custom clone sequence may differ by one or more nucleotides
  ATGGCGCCTCCGGCCCCCGGCCCGGCCTCCGGCGGCTCCGGGGAGGTAGACGAGCTGTTC
  GACGTAAAGAACGCCTTCTACATCGGCAGCTACCAGCAGTGCATAAACGAGGCGCAGCGG
  GTGAAGCTATCAAGCCCAGAGAGAGACGTGGAGAGGGACGTCTTCCTGTATAGAGCGTAC
  CTGGCGCAGAGGAAGTTCGGTGTGGTCCTGGATGAGATCAAGCCCTCCTCGGCCCCTGAG
  CTCCAGGCCGTGCGCATGTTTGCTGACTACCTCGCCCACGAGAGTCGGAGCACAGCCATG
  ACAGTGCAGATCCTGCTGAAGCTGGACCGCCTGGACCTCGCCCGGAAGGAGCTGAAGAGA
  ATGCAGGACCTGGACGAGGATGCCACCCTCACCCAGCTCGCCACTGCCTGGGTCAGCCTG
  GCCACGGGTGGTGAGAAGCTGCAGGATGCCTACTACATCTTCCAGGAGATGGCTGACAAG
  TGCTCGCCCACCCTGCTGCTGCTCAATGGGCAGGCGGCCTGCCACATGGCCCAGGGCCGC
  TGGGAGGCCGCTGAGGGCCTGCTGCAGGAGGCGCTAGACAAGGATAGTGGCTACCCAGAG
  ACGCTGGTCAACCTCATCGTCCTGTCCCAGCACCTGGGCAAGCCCCCTGAGGTGACAAAC
  CGATACCTGTCCCAGCTGAAGGATGCCCACAGGTCCCATCCCTTCATCAAGGAGTACCAG
  GCCAAGGAGAACGACTTTGACAGGCTGGTGCTACAGTACGCTCCCAGCGCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_199442
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_199442.1, NP_955474.1
• RefSeq Size: 981 bp
• RefSeq ORF: 774 bp
• Locus ID: 11316
• UniProt ID: O14579
• Cytogenetics: 19p13.11
• Gene Summary: The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (b), that is missing an internal segment compared to isoform a.