KCNA7 (NM_031886) Human Untagged Clone

CAT#: SC305352

KCNA7 (untagged)-Human potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7)


  "NM_031886" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-KCNA7 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "KCNA7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNA7
Synonyms HAK6; KV1.7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_031886 edited
ATGGAGCCGCGGTGCCCGCCGCCGTGCGGCTGCTGCGAGCGGCTGGTGCTCAACGTGGCC
GGGCTGCGCTTCGAGACGCGGGCGCGCACGCTGGGCCGCTTCCCGGACACTCTGCTAGGG
GACCCAGCGCGCCGCGGCCGCTTCTACGACGACGCGCGCCGCGAGTATTTCTTCGACCGG
CACCGGCCCAGCTTCGACGCCGTGCTCTACTACTACCAGTCCGGTGGGCGGCTGCGGCGG
CCGGCGCACGTGCCGCTCGACGTCTTCCTGGAAGAGGTGGCCTTCTACGGGCTGGGCGCG
GCGGCCCTGGCACGCCTGCGCGAGGACGAGGGCTGCCCGGTGCCGCCCGAGCGCCCCCTG
CCCCGCCGCGCCTTCGCCCGCCAGCTGTGGCTGCTTTTCGAGTTTCCCGAGAGCTCTCAG
GCCGCGCGCGTGCTCGCCGTAGTCTCCGTGCTGGTCATCCTCGTCTCCATCGTCGTCTTC
TGCCTCGAGACGCTGCCTGACTTCCGCGACGACCGCGACGGCACGGGGCTTGCTGCTGCA
GCCGCAGCCGGCCCGTTCCCCGCTCCGCTGAATGGCTCCAGCCAAATGCCTGGAAATCCA
CCCCGCCTGCCCTTCAATGACCCGTTCTTCGTGGTGGAGACGCTGTGTATTTGTTGGTTC
TCCTTTGAGCTGCTGGTACGCCTCCTGGTCTGTCCAAGCAAGGCTATCTTCTTCAAGAAC
GTGATGAACCTCATCGATTTTGTGGCTATCCTTCCCTACTTTGTGGCACTGGGCACCGAG
CTGGCCCGGCAGCGAGGGGTGGGCCAGCAGGCCATGTCACTGGCCATCCTGAGAGTCATC
CGATTGGTGCGTGTCTTCCGCATCTTCAAGCTGTCCCGGCACTCAAAGGGCCTGCAAATC
TTGGGCCAGACGCTTCGGGCCTCCATGCGTGAGCTGGGCCTCCTCATCTTTTTCCTCTTC
ATCGGTGTGGTCCTCTTTTCCAGCGCCGTCTACTTTGCCGAAGTTGACCGGGTGGACTCC
CATTTCACTAGCATCCCTGAGTCCTTCTGGTGGGCGGTAGTCACCATGACTACAGTTGGC
TATGGAGACATGGCACCCGTCACTGTGGGTGGCAAGATAGTGGGCTCTCTGTGTGCCATT
GCGGGCGTGCTGACTATTTCCCTGCCAGTGCCCGTCATTGTCTCCAATTTCAGCTACTTT
TATCACCGGGAGACAGAGGGCGAAGAGGCTGGGATGTTCAGCCATGTGGACATGCAGCCT
TGTGGCCCACTGGAGGGCAAGGCCAATGGGGGGCTGGTGGACGGGGAGGTACCTGAGCTA
CCACCTCCACTCTGGGCACCCCCAGGGAAACACCTGGTCACCGAAGTGTGA
Restriction Sites Please inquire     
ACCN NM_031886
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_031886.2, NP_114092.2
RefSeq Size 4372 bp
RefSeq ORF 1371 bp
Locus ID 3743
UniProt ID Q96RP8
Cytogenetics 19q13.33
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. The gene is expressed preferentially in skeletal muscle, heart and kidney. It is a candidate gene for inherited cardiac disorders. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.