OBP2A (NM_014582) Human Untagged Clone

CAT#: SC304133

OBP2A (untagged)-Human odorant binding protein 2A (OBP2A)


  "NM_014582" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-OBP2A Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "OBP2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OBP2A
Synonyms hOBPIIa; LCN13; OBP; OBP2C; OBPIIa
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_014582 edited
CCGAGGTCGGCAGCACAGAGCTCTGGAGATGAAGACCCTGTTCCTGGGTGTCACGCTCGG
CCTGGCCGCTGCCCTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTACGT
GAAGGCCATGGTGGTCGATAAGGACTTTCCGGAGGACAGGAGGCCCAGGAAGGTGTCCCC
AGTGAAGGTGACAGCCCTGGGCGGTGGGAACTTGGAAGCCACGTTCACCTTCATGAGGGA
GGATCGGTGCATCCAGAAGAAAATCCTGATGCGGAAGACGGAGGAGCCTGGCAAATTCAG
CGCCTATGGGGGCAGGAAGCTCATATACCTGCAGGAGCTGCCCGGGACGGACGACTACGT
CTTTTACTGCAAAGACCAGCGCCGTGGGGGCCTGCGCTACATGGGAAAGCTTGTGGGTAG
GAATCCTAATACCAACCTGGAGGCCCTGGAAGAATTTAAGAAATTGGTGCAGCACAAGGG
ACTCTCGGAGGAGGACATTTTCATGCCCCTGCAGACGGGAAGCTGCGTTCTCGAACACTA
GGCAGCCCCCGGGTCTGCACCTCCAGAGCCCACCCTACCACCAGACACAGA
Restriction Sites Please inquire     
ACCN NM_014582
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014582.1, NP_055397.1
RefSeq Size 676 bp
RefSeq ORF 513 bp
Locus ID 29991
UniProt ID Q9NY56
Cytogenetics 9q34.3
Protein Families Secreted Protein
Gene Summary This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (alpha, PMID:10607840) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant gamma. It encodes isoform alpha, which has a shorter and distinct C-terminus, compared to isoform gamma.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.