NKG2C (KLRC2) (NM_002260) Human Untagged Clone
CAT#: SC303159
KLRC2 (untagged)-Human killer cell lectin-like receptor subfamily C, member 2 (KLRC2)
"NM_002260" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NKG2C |
Synonyms | CD159c; NKG2-C; NKG2C |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_002260 edited
GAGATGAATAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGCGG CAGCAAAGGAAACCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATATTC CAAGTAGAATTAAATCTTCAAAATCCTTCCCTGAATCATCAAGGGATTGATAAAATATAT GACTGCCAAGGTTTACTGCCACCTCCAGAGAAGCTCACTGCCGAGGTCCTAGGAATCATT TGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTTCCTGGAGCAG AACAATTCTTCCCCGAATACAAGAACGCAGAAAGCACGTCATTGTGGCCATTGTCCTGAG GAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGGAA GAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAA GAAATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTAACAGC AGTCATCATCCATGGGTGACAATAAATGGTTTGGCTTTCAAACATAAGATAAAAGACTCA GATAATGCTGAACTTAACTGTGCAGTGCTACAAGTAAATCGACTTAAATCAGCCCAGTGT GGATCTTCAATGATATATCATTGTAAGCATAAGCTTTAG |
Restriction Sites | Please inquire |
ACCN | NM_002260 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002260.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002260.3, NP_002251.2 |
RefSeq Size | 1223 bp |
RefSeq ORF | 696 bp |
Locus ID | 3822 |
UniProt ID | P26717 |
Cytogenetics | 12p13.2 |
Protein Families | Transmembrane |
Protein Pathways | Antigen processing and presentation, Natural killer cell mediated cytotoxicity |
Gene Summary | Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The group, designated KLRC (NKG2) are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The KLRC (NKG2) gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. KLRC2 alternative splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211306 | KLRC2 (Myc-DDK-tagged)-Human killer cell lectin-like receptor subfamily C, member 2 (KLRC2) |
USD 300.00 |
|
RC211306L3 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 2 (KLRC2), Myc-DDK-tagged |
USD 600.00 |
|
RC211306L4 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 2 (KLRC2), mGFP tagged |
USD 600.00 |
|
RG211306 | KLRC2 (tGFP-tagged) - Human killer cell lectin-like receptor subfamily C, member 2 (KLRC2) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review