SULT1A4 (NM_001017389) Human Untagged Clone

CAT#: SC302029

SULT1A4 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4 (SULT1A4), transcript variant 1


  "NM_001017389" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SULT1A4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SULT1A4
Synonyms aryl sulfotransferase; phenol sulfotransferase; sulfokinase; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001017389, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGATCCAGGACACCTCCCGCCCGCCACTGGAGTACGTGAAGGGGGTCCCGCTCATCAAGTACT
TTGCAGAGGCACTGGGGCCCCTGCAGAGCTTCCAAGCCCGACCTGATGACCTGCTCATCAACACCTACCC
CAAGTCTGGCACCACCTGGGTGAGCCAGATACTGGACATGATCTACCAGGGCGGCGACCTAGAGAAGTGT
AACCGGGCTCCCATCTACGTACGGGTGCCCTTCCTTGAGGTCAATGATCCAGGGGAACCCTCAGGGCTGG
AGACTCTGAAAGACACACCGCCCCCACGGCTCATCAAGTCACACCTGCCCCTGGCTCTGCTCCCTCAGAC
TCTGTTGGATCAGAAGGTCAAGGTGGTCTATGTTGCCCGAAACCCAAAGGACGTGGCGGTCTCCTACTAC
CATTTCCACCGTATGGAAAAGGCGCACCCTGAGCCTGGGACCTGGGACAGCTTCCTGGAAAAGTTCATGG
CTGGAGAAGTGTCCTACGGGTCCTGGTACCAGCACGTGCAGGAGTGGTGGGAGCTGAGCCGCACCCACCC
TGTTCTCTACCTCTTCTATGAAGACATGAAGGAGAACCCCAAAAGGGAGATTCAAAAGATCCTGGAGTTT
GTGGGGCGCTCCCTGCCAGAGGAGACCATGGACTTCATGGTTCAGCACACGTCGTTCAAGGAGATGAAGA
AGAACCCTATGACCAACTACACCACCGTCCCCCAGGAGCTCATGGACCACAGCATCTCCCCCTTCATGAG
GAAAGGCATGGCTGGGGACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTAT
GCGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGA


Restriction Sites NotI-NotI     
ACCN NM_001017389
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001017389.1, NP_001017389.1
RefSeq Size 1574 bp
RefSeq ORF 888 bp
Locus ID 445329
Cytogenetics 16p11.2
Protein Pathways Sulfur metabolism
Gene Summary Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16, this gene and SULT1A3 arose from a segmental duplication. Read-through transcription exists between this gene and the upstream SLX1B (SLX1 structure-specific endonuclease subunit homolog B) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) is the longest variant. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.