MRPL22 (NM_001014990) Human Untagged Clone
CAT#: SC301980
MRPL22 (untagged)-Human mitochondrial ribosomal protein L22 (MRPL22), nuclear gene encoding mitochondrial protein, transcript variant 2
"NM_001014990" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRPL22 |
Synonyms | HSPC158; L22mt; MRP-L22; MRP-L25; RPML25 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001014990, the custom clone sequence may differ by one or more nucleotides
ATGTGGTATTTGGCAAAATTGATACGAGGAATGTCTATTGACCAGGCTTTGGCTCAGTTG GAATTCAATGACAAAAAAGGGGCCAAAATAATTAAAGAGGTTCTCTTAGAAGCACAAGAT ATGGCAGTGAGAGACCATAACGTGGAATTCAGGTCCAATTTATATATAGCTGAGTCCACC TCAGGACGAGGCCAGTGCCTGAAACGCATCCGCTACCATGGCAGAGGTCGCTTTGGGATC ATGGAGAAGGTTTATTGCCATTATTTTGTGAAGTTGGTGGAAGGGCCCCCACCTCCACCT GAGCCACCAAAGACGGCAGTTGCCCATGCCAAAGAGTATATTCAGCAGCTTCGCAGCCGG ACCATCGTTCACACTCTATGA |
Restriction Sites | Please inquire |
ACCN | NM_001014990 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001014990.1, NP_001014990.1 |
RefSeq Size | 616 bp |
RefSeq ORF | 381 bp |
Locus ID | 29093 |
UniProt ID | Q9NWU5 |
Cytogenetics | 5q33.2 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L22 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 4q. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219015 | MRPL22 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L22 (MRPL22), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 150.00 |
|
RC219015L1 | Lenti-ORF clone of MRPL22 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L22 (MRPL22), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 450.00 |
|
RC219015L2 | Lenti-ORF clone of MRPL22 (mGFP-tagged)-Human mitochondrial ribosomal protein L22 (MRPL22), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 450.00 |
|
RC219015L3 | Lenti-ORF clone of MRPL22 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L22 (MRPL22), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 450.00 |
|
RC219015L4 | Lenti-ORF clone of MRPL22 (mGFP-tagged)-Human mitochondrial ribosomal protein L22 (MRPL22), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 450.00 |
|
RG219015 | MRPL22 (tGFP-tagged) - Human mitochondrial ribosomal protein L22 (MRPL22), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review