MAGEA4 (NM_001011549) Human Untagged Clone
CAT#: SC301577
MAGEA4 (untagged)-Human melanoma antigen family A, 4 (MAGEA4), transcript variant 3
"NM_001011549" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAGEA4 |
Synonyms | CT1.4; MAGE-41; MAGE-X2; MAGE4; MAGE4A; MAGE4B |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001011549 edited
ATGTCTTCTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCGTTGAGGCCCAAGAA GAGGCCCTGGGCCTGGTGGGTGCACAGGCTCCTACTACTGAGGAGCAGGAGGCTGCTGTC TCCTCCTCCTCTCCTCTGGTCCCTGGCACCCTGGAGGAAGTGCCTGCTGCTGAGTCAGCA GGTCCTCCCCAGAGTCCTCAGGGAGCCTCTGCCTTACCCACTACCATCAGCTTCACTTGC TGGAGGCAACCCAATGAGGGTTCCAGCAGCCAAGAAGAGGAGGGGCCAAGCACCTCGCCT GACGCAGAGTCCTTGTTCCGAGAAGCACTCAGTAACAAGGTGGATGAGTTGGCTCATTTT CTGCTCCGCAAGTATCGAGCCAAGGAGCTGGTCACAAAGGCAGAAATGCTGGAGAGAGTC ATCAAAAATTACAAGCGCTGCTTTCCTGTGATCTTCGGCAAAGCCTCCGAGTCCCTGAAG ATGATCTTTGGCATTGACGTGAAGGAAGTGGACCCCACCAGCAACACCTACACCCTTGTC ACCTGCCTGGGCCTTTCCTATGATGGCCTGCTGGGTAATAATCAGATCTTTCCCAAGACA GGCCTTCTGATAATCGTCCTGGGCACAATTGCAATGGAGGGCGACAGCGCCTCTGAGGAG GAAATCTGGGAGGAGCTGGGTGTGATGGGGGTGTATGATGGGAGGGAGCACACTGTCTAT GGGGAGCCCAGGAAACTGCTCACCCAAGATTGGGTGCAGGAAAACTACCTGGAGTACCGG CAGGTACCCGGCAGTAATCCTGCGCGCTATGAGTTCCTGTGGGGTCCAAGGGCTCTGGCT GAAACCAGCTATGTGAAAGTCCTGGAGCATGTGGTCAGGGTCAATGCAAGAGTTCGCATT GCCTACCCATCCCTGCGTGAAGCAGCTTTGTTAGAGGAGGAAGAGGGAGTCTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_001011549 |
Insert Size | 1700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001011549. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001011549.1, NP_001011549.1 |
RefSeq Size | 1721 bp |
RefSeq ORF | 954 bp |
Locus ID | 4103 |
UniProt ID | P43358 |
Cytogenetics | Xq28 |
Gene Summary | This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204482 | MAGEA4 (Myc-DDK-tagged)-Human melanoma antigen family A, 4 (MAGEA4), transcript variant 3 |
USD 300.00 |
|
RC204482L3 | Lenti-ORF clone of MAGEA4 (Myc-DDK-tagged)-Human melanoma antigen family A, 4 (MAGEA4), transcript variant 3 |
USD 600.00 |
|
RC204482L4 | Lenti-ORF clone of MAGEA4 (mGFP-tagged)-Human melanoma antigen family A, 4 (MAGEA4), transcript variant 3 |
USD 600.00 |
|
RG204482 | MAGEA4 (tGFP-tagged) - Human melanoma antigen family A, 4 (MAGEA4), transcript variant 3 |
USD 500.00 |
|
SC322468 | MAGEA4 (untagged)-Human melanoma antigen family A, 4 (MAGEA4), transcript variant 3 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review