EDA (NM_001005609) Human Untagged Clone

CAT#: SC301003

EDA (untagged)-Human ectodysplasin A (EDA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EDA
• Synonyms: ECTD1; ED1; ED1-A1; ED1-A2; EDA-A1; EDA-A2; EDA1; EDA2; HED; HED1; ODT1; STHAGX1; TNLG7C; XHED; XLHED
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001005609, the custom clone sequence may differ by one or more nucleotides
  ATGGGCTACCCGGAGGTGGAGCGCAGGGAACTCCTGCCTGCAGCAGCGCCGCGGGAGCGA
  GGGAGCCAGGGCTGCGGGTGTGGCGGGGCCCCTGCCCGGGCGGGCGAAGGGAACAGCTGC
  CTGCTCTTCCTGGGTTTCTTTGGCCTCTCGCTGGCCCTCCACCTGCTGACGTTGTGCTGC
  TACCTAGAGTTGCGCTCGGAGTTGCGGCGGGAACGTGGAGCCGAGTCCCGCCTTGGCGGC
  TCGGGCACCCCTGGCACCTCTGGCACCCTAAGCAGCCTCGGTGGCCTCGACCCTGACAGC
  CCCATCACCAGTCACCTTGGGCAGCCGTCACCTAAGCAGCAGCCATTGGAACCGGGAGAA
  GCCGCACTCCACTCTGACTCCCAGGACGGGCACCAGATGGCCCTATTGAATTTCTTCTTC
  CCTGATGAAAAGCCATACTCTGAAGAAGAAAGTAGGCGTGTTCGCCGCAATAAAAGAAGC
  AAAAGCAATGAAGGAGCAGATGGCCCAGTTAAAAACAAGAAAAAGGGAAAGAAAGCAGGA
  CCTCCTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCCCAGGGACCCCCA
  GGAATTCCAGGGATTCCTGGAATTCCAGGAACAACTGTTATGGGACCACCTGGTCCTCCA
  GGTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGGGACCTTCTGGTGCTGCTGATAAA
  GCTGGAACTCGAGAAAACCAGCCAGCTGTGGTGCATCTACAGGGCCAAGGGTCAGCAATT
  CAAGTCAAGAATGATCTTTCAGGTGGAGTGCTCAATGACTGGTCTCGCATCACTATGAAC
  CCCAAGGTGTTTAAGCTACATCCCCGCAGCGGGGAGCTGGAGGTACTGGTGGACGGCACC
  TACTTCATCTATAGTCAGGTATACTACATCAACTTCACTGACTTTGCCAGCTATGAGGTG
  GTGGTGGATGAGAAGCCCTTCCTGCAGTGCACACGCAGCATCGAGACGGGCAAGACCAAC
  TACAACACTTGCTATACCGCAGGCGTCTGCCTCCTCAAGGCCCGGCAGAAGATCGCCGTC
  AAGATGGTGCACGCTGACATCTCCATCAACATGAGCAAGCACACCACGTTCTTTGGGGCC
  ATCAGGCTGGGTGAAGCCCCTGCATCCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001005609
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001005609.1, NP_001005609.1
• RefSeq Size: 5290 bp
• RefSeq ORF: 1170 bp
• Locus ID: 1896
• UniProt ID: Q92838
• Cytogenetics: Xq13.1
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting isoform (2, also known as EDA-A2) has the same N- and C-termini but is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.