PKI alpha (PKIA) (NM_006823) Human Untagged Clone

CAT#: SC126968

PKIA (untagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor alpha (PKIA), transcript variant 1


  "NM_006823" in other vectors (6)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PKIA mouse monoclonal antibody,clone OTI1G5
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PKI alpha"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PKI alpha
Synonyms PRKACN1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC126968 sequence for NM_006823 edited (data generated by NextGen Sequencing)
ATGACTGATGTGGAAACTACATATGCAGATTTTATTGCTTCAGGAAGAACAGGTAGAAGA
AATGCAATACATGATATCCTGGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTG
AAATTAGCAGGTCTTGATATCAACAAGACAGAAGGTGAAGAAGATGCACAACGAAGTTCT
ACAGAACAAAGTGGGGAAGCCCAGGGAGAAGCAGCAAAATCTGAAAGCTAA

Clone variation with respect to NM_006823.3
>OriGene 5' read for NM_006823 unedited
TATACGACTCACTATAGGGCGGCCGCGAATTCGCACGAGGGGAGCGGAGGCTGCTGCTGG
CAGGTGGGGCGCGGGCCGGCGCGAGCTGACCGAGCACTCGGCGGGCGCGGCGGGACTGCG
GCCCGTGGCGGCGTGCGCGGGGACCTGCGCTGACTAGGTCCGGGGAAGTTTCCTGACTTT
CTGAGAAGCCCTGGTTTCCCCAAAGAAGTGATTTCTGATAGAAATCTGAAGGTCATCTCC
AAGAAAAAAGAGATCTAGTATAGTCAATGAATTAAAGACAAGAAGGTTTCCAATCAGTCC
CTGCTATGTGGATATTTGGTAGCAATGACTGATGTGGAAACTACATATGCAGATTTTATT
GCTTCAGGAAGAACAGGTAGAAGAAATGCAATACATGATATCCTGGTTTCCTCTGCAAGT
GGCAACAGCAATGAATTAGCCTTGAAATTAGCAGGTCTTGATATCAACAAGACAGAAGGT
GAAGAAGATGCACAACGAAGTTCTACAGAACAAAGTGGGGAAGCCCAGGGAGAAGCAGCA
AAATCTGAAAGCTAACACCCCACTTTGACCCTCGACCACACCTGANAATGTCTCANATCT
CCAGGAGTATCTGGAATGCATTTTGTTTCCATGAGTGAAAAGAGGAAAAAGAAAATGGGC
TGTGCTGCATTGCANGAACCTGCTCATTATCATGTNTAAAAATGAGGGCAGAGGCTGTGG
CTGCAGGCAGACTTTTTCCCTTACCTCTGTCATTAGCCNATGGNTGAAAATCATGTGGCT
TTGGTGGTTTGGGCGTCAATTTTGGATGGGATCCTTTCACCTNGTCATATGACCAAATGC
TTATAGAGAGTAGCCTCGACCTAGAGGAAGAATCTTTCTGTAGCATCTTGGCCCTTACAT
GTCCNAGGAATTAATTGGGGCAATTTCGCAGAGGGTGTTTGAACCCCGAGTTAAATTTT
Restriction Sites NotI-NotI     
ACCN NM_006823
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006823.2, NP_006814.1
RefSeq Size 2184 bp
RefSeq ORF 231 bp
Locus ID 5569
UniProt ID P61925
Cytogenetics 8q21.13
Domains PKI
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a member of the cAMP-dependent protein kinase (PKA) inhibitor family. This protein was demonstrated to interact with and inhibit the activities of both C alpha and C beta catalytic subunits of the PKA. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) differs the in the 5' UTR, as compared to variant 2. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.