TLR9 (NM_017442) Human Untagged Clone

CAT#: SC122858

TLR9 (untagged)-Human toll-like receptor 9 (TLR9)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TLR9 (NM_017442) Human Untagged Clone
Symbol TLR9
Synonyms CD289
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_017442 edited
CCACGCGTCCGGGGACCTCGAGTGTGAAGCATCCTTCCCTGTAGCTGCTGTCCAGTCTGC
CCGCCAGACCCTCTGGAGAAGCCCCTGCCCCCCAGCATGGGTTTCTGCCGCAGCGCCCTG
CACCCGCTGTCTCTCCTGGTGCAGGCCATCATGCTGGCCATGACCCTGGCCCTGGGTACC
TTGCCTGCCTTCCTACCCTGTGAGCTCCAGCCCCACGGCCTGGTGAACTGCAACTGGCTG
TTCCTGAAGTCTGTGCCCCACTTCTCCATGGCAGCACCCCGTGGCAATGTCACCAGCCTT
TCCTTGTCCTCCAACCGCATCCACCACCTCCATGATTCTGACTTTGCCCACCTGCCCAGC
CTGCGGCATCTCAACCTCAAGTGGAACTGCCCGCCGGTTGGCCTCAGCCCCATGCACTTC
CCCTGCCACATGACCATCGAGCCCAGCACCTTCTTGGCTGTGCCCACCCTGGAAGAGCTA
AACCTGAGCTACAACAACATCATGACTGTGCCTGCGCTGCCCAAATCCCTCATATCCCTG
TCCCTCAGCCATACCAACATCCTGATGCTAGACTCTGCCAGCCTCGCCGGCCTGCATGCC
CTGCGCTTCCTATTCATGGACGGCAACTGTTATTACAAGAACCCCTGCAGGCAGGCACTG
GAGGTGGCCCCGGGTGCCCTCCTTGGCCTGGGCAACCTCACCCACCTGTCACTCAAGTAC
AACAACCTCACTGTGGTGCCCCGCAACCTGCCTTCCAGCCTGGAGTATCTGCTGTTGTCC
TACAACCGCATCGTCAAACTGGCGCCTGAGGACCTGGCCAATCTGACCGCCCTGCGTGTG
CTCGATGTGGGCGGAAATTGCCGCCGCTGCGACCACGCTCCCAACCCCTGCATGGAGTGC
CCTCGTCACTTCCCCCAGCTACATCCCGATACCTTCAGCCACCTGAGCCGTCTTGAAGGC
CTGGTGTTGAAGGACAGTTCTCTCTCCTGGCTGAATGCCAGTTGGTTCCGTGGGCTGGGA
AACCTCCGAGTGCTGGACCTGAGTGAGAACTTCCTCTACAAATGCATCACTAAAACCAAG
GCCTTCCAGGGCCTAACACAGCTGCGCAAGCTTAACCTGTCCTTCAATTACCAAAAGAGG
GTGTCCTTTGCCCACCTGTCTCTGGCCCCTTCCTTCGGGAGCCTGGTCGCCCTGAAGGAG
CTGGACATGCACGGCATCTTCTTCCGCTCACTCGATGAGACCACGCTCCGGCCACTGGCC
CGCCTGCCCATGCTCCAGACTCTGCGTCTGCAGATGAACTTCATCAACCAGGCCCAGCTC
GGCATCTTCAGGGCCTTCCCTGGCCTGCGCTACGTGGACCTGTCGGACAACCGCATCAGC
GGAGCTTCGGAGCTGACAGCCACCATGGGGGAGGCAGATGGAGGGGAGAAGGTCTGGCTG
CAGCCTGGGGACCTTGCTCCGGCCCCAGTGGACACTCCCAGCTCTGAAGACTTCAGGCCC
AACTGCAGCACCCTCAACTTCACCTTGGATCTGTCACGGAACAACCTGGTGACCGTGCAG
CCGGAGATGTTTGCCCAGCTCTCGCACCTGCAGTGCCTGCGCCTGAGCCACAACTGCATC
TCGCAGGCAGTCAATGGCTCCCAGTTCCTGCCGCTGACCGGTCTGCAGGTGCTAGACCTG
TCCCACAATAAGCTGGACCTCTACCACGAGCACTCATTCACGGAGCTACCACGACTGGAG
GCCCTGGACCTCAGCTACAACAGCCAGCCCTTTGGCATGCAGGGCGTGGGCCACAACTTC
AGCTTCGTGGCTCACCTGCGCACCCTGCGCCACCTCAGCCTGGCCCACAACAACATCCAC
AGCCAAGTGTCCCAGCAGCTCTGCAGTACGTCGCTGCGGGCCCTGGACTTCAGCGGCAAT
GCACTGGGCCATATGTGGGCCGAGGGAGACCTCTATCTGCACTTCTTCCAAGGCCTGAGC
GGTTTGATCTGGCTGGACTTGTCCCAGAACCGCCTGCACACCCTCCTGCCCCAAACCCTG
CGCAACCTCCCCAAGAGCCTACAGGTGCTGCGTCTCCGTGACAATTACCTGGCCTTCTTT
AAGTGGTGGAGCCTCCACTTCCTGCCCAAACTGGAAGTCCTCGACCTGGCAGGAAACCAG
CTGAAGGCCCTGACCAATGGCAGCCTGCCTGCTGGCACCCGGCTCCGGAGGCTGGATGTC
AGCTGCAACAGCATCAGCTTCGTGGCCCCCGGCTTCTTTTCCAAGGCCAAGGAGCTGCGA
GAGCTCAACCTTAGCGCCAACGCCCTCAAGACAGTGGACCACTCCTGGTTTGGGCCCCTG
GCGAGTGCCCTGCAAATACTAGATGTAAGCGCCAACCCTCTGCACTGCGCCTGTGGGGCG
GCCTTTATGGACTTCCTGCTGGAGGTGCAGGCTGCCGTGCCCGGTCTGCCCAGCCGGGTG
AAGTGTGGCAGTCCGGGCCAGCTCCAGGGCCTCAGCATCTTTGCACAGGACCTGCGCCTC
TGCCTGGATGAGGCCCTCTCCTGGGACTGTTTCGCCCTCTCGCTGCTGGCTGTGGCTCTG
GGCCTGGGTGTGCCCATGCTGCATCACCTCTGTGGCTGGGACCTCTGGTACTGCTTCCAC
CTGTGCCTGGCCTGGCTTCCCTGGCGGGGGCGGCAAAGTGGGCGAGATGAGGATGCCCTG
CCCTACGATGCCTTCGTGGTCTTCGACAAAACGCAGAGCGCAGTGGCAGACTGGGTGTAC
AACGAGCTTCGGGGGCAGCTGGAGGAGTGCCGTGGGCGCTGGGCACTCCGCCTGTGCCTG
GAGGAACGCGACTGGCTGCCTGGCAAAACCCTCTTTGAGAACCTGTGGGCCTCGGTCTAT
GGCAGCCGCAAGACGCTGTTTGTGCTGGCCCACACGGACCGGGTCAGTGGTCTCTTGCGC
GCCAGCTTCCTGCTGGCCCAGCAGCGCCTGCTGGAGGACCGCAAGGACGTCGTGGTGCTG
GTGATCCTGAGCCCTGACGGCCGCCGCTCCCGCTACGTGCGGCTGCGCCAGCGCCTCTGC
CGCCAGAGTGTCCTCCTCTGGCCCCACCAGCCCAGTGGTCAGCGCAGCTTCTGGGCCCAG
CTGGGCATGGCCCTGACCAGGGACAACCACCACTTCTATAACCGGAACTTCTGCCAGGGA
CCCACGGCCGAATAGCCGTGAGCCGGAATCCTGCACGGTGCCACCTCCACACTCACCTCA
CCTCTGCCTGCCTGGTCTGACCCTCCCCTGCTCGCCTCCCTCACCCCACACCTGACACAG
AGCAGGCACTCAATAAATGCTACCGAAGGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_017442 unedited
NNNNAAAGTTCAGATTTTGTAATACGACTTCACTATAGGGCGGGCCGCGCAATTCCCGGG
GTATCGTCGACCCACGCGTCCGGGGACCTCGAGTGTGAAGCATCCTTCCCTGTAGCTGCT
GTCCAGTCTGCCCGCCAGACCCTCTGGAGAAGCCCCTGCCCCCCAGCATGGGTTTCTGCC
GCAGCGCCCTGCACCCGCTGTCTCTCCTGGTGCAGGCCATCATGCTGGCCATGACCCTGG
CCCTGGGTACCTTGCCTGCCTTCCTACCCTGTGAGCTCCAGCCCCACGGCCTGGTGAACT
GCAACTGGCTGTTCCTGAAGTCTGTGCCCCACTTCTCCATGGCAGCACCCCGTGGCAATG
TCACCAGCCTTTCCTTGTCCTCCAACCGCATCCACCACCTCCATGATTCTGACTTTGCCC
ACCTGCCCAGCCTGCGGCATCTCAACCTCAAGTGGAACTGCCCGCCGGTTGGCCTCAGCC
CCATGCACTTCCCCTGCCACATGACCATCGAGCCCAGCACCTTCTTGGCTGTGCCCACCC
TGGAAGAGCTAAACCTGAGCTACAACAACATCATGACTGTGCCTGCGCTGCCCAAATCCC
TCATATCCCTGTCCCTCAGCCATACCAACATCCTGATGCTAGACTCTGCCAGCCTCGCCG
GCCTGCATGCCCTGCGCTTCCTATTCATGGACGGCAACTGTTATTACAAGAACCCCTGCA
GGCAGGCACTGGAGGTGGCCCCGGGTGCCCCTCTTGGCCTGGGGCACCTCACCCACCTGT
CACTCAAGTACAACAACCTCACTGTGGTGCCCCGGCACCTGCCCTTCAGCCCTGGAGTAT
CTGCTGGTTGTCCTACAACCGCATCGTTCAACTGGGCGCCTGAGGACCTTGGCCAATCTG
ACCGC
Tag Tag Free
ACCN NM_017442
ORF Size 3099 bp
Insert Size 3384
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_017442.2, NP_059138
RefSeq Size 3868
RefSeq ORF 3099
Locus ID 54106
Cytogenetics 3p21.2
Protein Families Transmembrane, Druggable Genome
Protein Pathways Toll-like receptor signaling pathway
Gene Summary The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (A) is a biexonic transcript which encodes the longer isoform (A).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations