Aconitase 2(ACO2) (NM_001098) Human Untagged Clone

CAT#: SC119428

ACO2 (untagged)-Human aconitase 2, mitochondrial (ACO2), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Aconitase 2(ACO2) (NM_001098) Human Untagged Clone
Symbol ACO2
Synonyms ACONM; HEL-S-284; ICRD; OCA8; OPA9
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001098, the custom clone sequence may differ by one or more nucleotides


ATGGCGCCCTACAGCCTACTGGTGACTCGGCTGCAGAAAGCTCTGGGTGTGCGGCAGTACCATGTGGCCT
CAGTCCTGTGCCAACGGGCCAAGGTGGCGATGAGCCACTTTGAGCCCAACGAGTACATCCATTATGACCT
GCTAGAGAAGAACATTAACATTGTTCGCAAACGACTGAACCGGCCGCTGACACTCTCGGAGAAGATTGTG
TATGGACACCTGGATGACCCCGCCAGCCAGGAAATTGAGCGAGGCAAGTCGTACCTGCGGCTGCGGCCGG
ACCGTGTGGCCATGCAGGATGCGACGGCCCAGATGGCCATGCTCCAGTTCATCAGCAGCGGGCTGTCCAA
GGTGGCTGTGCCATCCACCATCCACTGTGACCATCTGATTGAAGCCCAGGTTGGGGGCGAGAAAGACCTG
CGCCGGGCCAAGGACATCAACCAGGAAGTTTATAATTTCCTGGCAACTGCAGGTGCCAAATATGGCGTGG
GCTTCTGGAAGCCTGGATCTGGAATCATTCACCAGATTATTCTGGAAAACTATGCGTACCCTGGTGTTCT
TCTGATTGGCACTGACTCCCACACCCCCAATGGTGGCGGCCTTGGGGGCATCTGCATTGGAGTTGGGGGT
GCCGATGCTGTGGATGTCATGGCTGGGATCCCCTGGGAGCTGAAGTGCCCCAAGGTGATTGGCGTGAAGC
TGACGGGCTCTCTCTCCGGTTGGTCCTCACCCAAAGATGTGATCCTGAAGGTGGCAGGCATCCTCACGGT
GAAAGGTGGCACAGGTGCAATCGTGGAATACCACGGGCCTGGTGTAGACTCCATCTCCTGCACTGGCATG
GCGACAATCTGCAACATGGGTGCAGAAATTGGGGCCACCACTTCCGTGTTCCCTTACAACCACAGGATGA
AGAAGTACCTGAGCAAGACCGGCCGGGAAGACATTGCCAATCTAGCTGATGAATTCAAGGATCACTTGGT
GCCTGACCCTGGCTGCCATTATGACCAACTAATTGAAATTAACCTCAGTGAGCTGAAGCCACACATCAAT
GGGCCCTTCACCCCTGACCTGGCTCACCCTGTGGCAGAAGTGGGCAAGGTGGCAGAGAAGGAAGGATGGC
CTCTGGACATCCGAGTGGGTCTAATTGGTAGCTGCACCAATTCAAGCTATGAAGATATGGGGCGCTCAGC
AGCTGTGGCCAAGCAGGCACTGGCCCATGGCCTCAAGTGCAAGTCCCAGTTCACCATCACTCCAGGTTCC
GAGCAGATCCGCGCCACCATTGAGCGGGACGGCTATGCACAGATCTTGAGGGATCTGGGTGGCATTGTCC
TGGCCAATGCTTGTGGCCCCTGCATTGGCCAGTGGGACAGGAAGGACATCAAGAAGGGGGAGAAGAACAC
AATCGTCACCTCCTACAACAGGAACTTCACGGGCCGCAACGACGCAAACCCCGAGACCCATGCCTTTGTC
ACGTCCCCAGAGATTGTCACAGCCCTGGCCATTGCGGGAACCCTCAAGTTCAACCCAGAGACCGACTACC
TGACGGGCACGGATGGCAAGAAGTTCAGGCTGGAGGCTCCGGATGCAGATGAGCTTCCCAAAGGGGAGTT
TGACCCAGGGCAGGACACCTACCAGCACCCACCCAAGGACAGCAGCGGGCAGCATGTGGACGTGAGCCCC
ACCAGCCAGCGCCTGCAGCTCCTGGAGCCTTTTGACAAGTGGGATGGCAAGGACCTGGAGGACCTGCAGA
TCCTCATCAAGGTCAAAGGGAAGTGTACCACTGACCACATCTCAGCTGCTGGCCCCTGGCTCAAGTTCCG
TGGGCACTTGGATAACATCTCCAACAACCTGCTCATTGGTGCCATCAACATTGAAAACGGCAAGGCCAAC
TCCGTGCGCAATGCCGTCACTCAGGAGTTTGGCCCCGTCCCTGACACTGCCCGCTACTACAAGAAACATG
GCATCAGGTGGGTGGTGATCGGAGACGAGAACTACGGCGAGGGCTCGAGCCGGGAGCATGCAGCTCTGGA
GCCTCGCCACCTTGGGGGCCGGGCCATCATCACCAAGAGCTTTGCCAGGATCCACGAGACCAACCTGAAG
AAACAGGGCCTGCTGCCTCTGACCTTCGCTGACCCGGCTGACTACAACAAGATTCACCCTGTGGACAAGC
TGACCATTCAGGGCCTGAAGGACTTCACCCCTGGCAAGCCCCTGAAGTGCATCATCAAGCACCCCAACGG
GACCCAGGAGACCATCCTCCTGAACCACACCTTCAACGAGACGCAGATTGAGTGGTTCCGCGCTGGCAGT
GCCCTCAACAGAATGAAGGAACTGCAACAGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_001098 unedited
ACGACTCACTATAGGGCGGCCGCGATTCGGCACGAGGCACAAAAGGCGCCCTACAGCCTA
CTGGTGACTCGGCTGCAGAAAGCTCTGGGTGTGCGGCAGTACCATGTGGCCTCAGTCCTG
TGCCAACGGGCCAAGGTGGCGATGAGCCACTTTGAGCCCAACGAGTACATCCATTATGAC
CTGCTAGAGAAGAACATTAACATTGTTCGCAAACGACTGAACCGGCCGCTGACACTCTCG
GAGAAGATTGTGTATGGACACCTGGATGACCCCGCCAGCCAGGAAATTGAGCGAGGCAAG
TCGTACCTGCGGCTGCGGCCGGACCGTGTGGCCATGCAGGATGCGACGGCCCAGATGGCC
ATGCTCCAGTTCATCAGCAGCGGGCTGTCCAAGGTGGCTGTGCCATCCACCATCCACTGT
GACCATCTGATTGAAGCCCAGGTTGGGGGCGAGAAAGACCTGCGCCGGGCCAAGGACATC
AACCAGGAAGTTTATAATTTCCTGGCAACTGCAGGTGCCAAATATGGCGTGGGCTTCTGG
AAGCCTGGATCTGGAATCATTCACCAGATTATTCTGGAAAACTATGCGTACCCTGGTGTT
CTTCTGATTGGCACTGACTCCCACACCCCCAATGGTGGCGGCCTTGGNGGCATCTGCATT
GGAGTTGGGGGTGCCGATGCTGTGGATGTCATGGCTGGGATCCCCTGGGAGTTGAAGTGC
CCCAGGGTGATTGGCGTGAAGCTGACGGGCTCTCTCTCCGGTTGGTCCTCACCAAAGATG
TGATCCTGAAGGTGCANGCATNCTCACGGTGAAGGGTGCACAGGTGNCATCGTGGATACC
ACGGCCCTGGTGTANACTCCATCTNCTGCACTGGCATGGCGACAATCTGCANCATGGGTG
CAGAAAATGGGGCAACCACTTCGTGTTCCTTACACCCAGGAGNANAAGTACCTGACAGAC
GGNCGGAGAACTTGCATTACTGT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001098 unedited
GCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGTTTG
GAATCTTGGTTTCCTTGCAAAAACAAAAGGGTCTTTTAAATCCTTCAGCCCCCCATGAAA
TGATCAGGCCGGAAAAAAACTTTAAATGGGAGTCTTGTCATCAAAAATAAATACCGTTGC
CTGGAGCTGGTTAAAATACTGAACCCAACTCCAAATAGGAAAACGGGGGCTTAAAAGTTA
TTTTAAAAACCCCCCCACCACAACCACAGTCACTCCGTGGGCTAAACGGGGAACAAGAAA
CATGTCTGGGCACACCATCTTGGAATAAGAAACCCTGGCTGGACGGATCGGATCCACTGG
TGGGCCACCTGGAGCTGAACTTTACGCCCCCGGCGGGGCGGGGAAGCACTGCCCTCACTG
GTGCAGGTCCTTTATTTTGTTGAGGGCACTGGCAGCGCGGAACCACTCAATCTGCGTCTT
GTTGAAAGGGTGGGTCAAGAGGATGGTCTCCTGGGTCCCCTTGGGGTGCTTGATGATGCA
CTTTAAGGGCTTGCCAGGGGTGAAATCCCTTAAGCCCTGAATGGTCAACTTGTCCCAGGG
TGAATTTTGTTGTAATCACCCGGGTCACCCAAAGTCATAAGCCACAAGCCCTGTTTCCTT
ACGGTGGGCCTCGGGGATCCTCGCACAACTTTTGGTGAATGAATGCCCCGGCCCCCAAGG
TGGCGAAGGGTTCCCAAACTGGTTGCTCCCCGGCTCCAAACCTCCGCCGCATTTTCTCGT
TTCCGATTCCCCCCCCCTTAATCCCAGTCTCCTTTTCCCTTTCCCCCCGGTCTTGGCCCG
CTCTCATCTTCCCCCGTACCCTCTCTCCCATTGTTTCCCCCTCCACCCTTTTCTTCCTCC
CCCCCTTCACCTCTCTTCTTTCGTTCCTTCACCGCCCTCTCCTTCCCCCCCCCTTACCCC
TCCTCCTACTTCTCCCCCTCCCCCATTTCTTCCATCTCCCCTCTACTCCCTCGCATCTTT
CCTCTAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001098
ORF Size 2343 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001098.2, NP_001089
RefSeq Size 2744
RefSeq ORF 2343
Locus ID 50
Cytogenetics 22q13.2
Domains Aconitase_C, aconitase
Protein Pathways Citrate cycle (TCA cycle), Glyoxylate and dicarboxylate metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.