c-Jun(JUN) (NM_002228) Human Untagged Clone

CAT#: SC118762

JUN (untagged)-Human jun proto-oncogene (JUN)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name c-Jun(JUN) (NM_002228) Human Untagged Clone
Symbol JUN
Synonyms AP-1; AP1; c-Jun
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002228 edited
GAATTCGGCACGAGGGTGGCTGAAGCAGCGAGGCGGGAGTGGAGGTGCGCGGAGTCAGGC
AGACAGACAGACACAGCCAGCCAGCCAGGTCGGCAGTATAGTCCGAACTGCAAATCTTAT
TTTCTTTTCACCTTCTCTCTAACTGCCCAGAGCTAGCGCCTGTGGCTCCCGGGCTGGTGT
TTCGGGAGTGTCCAGAGAGCCTGGTCTCCAGCCGCCCCCGGGAGGAGAGCCCTGCTGCCC
AGGCGCTGTTGACAGCGGCGGAAAGCAGCGGTACCCACGCGCCCGCCGGGGGAAGTCGGC
GAGCGGCTGCAGCAGCAAAGAACTTTCCCGGCTGGGAGGACCGGAGACAAGTGGCAGAGT
CCCGGAGCGAACTTTTGCAAGCCTTTCCTGCGTCTTAGGCTTCTCCACGGCGGTAAAGAC
CAGAAGGCGGCGGAGAGCCACGCAAGAGAAGAAGGACGTGCGCTCAGCTTCGCTCGCACC
GGTTGTTGAACTTGGGCGAGCGCGAGCCGCGGCTGCCGGGCGCCCCCTCCCCCTAGCAGC
GGAGGAGGGGACAAGTCGTCGGAGTCCGGGCGGCCAAGACCCGCCGCCGGCCGGCCACTG
CAGGGTCCGCACTGATCCGCTCCGCGGGGAGAGCCGCTGCTCTGGGAAGTGAGTTCGCCT
GCGGACTCCGAGGAACCGCTGCGCCCGAAGAGCGCTCAGTGAGTGACCGCGACTTTTCAA
AGCCGGGTAGCGCGCGCGAGTCGACAAGTAAGAGTGCGGGAGGCATCTTAATTAACCCTG
CGCTCCCTGGAGCGAGCTGGTGAGGAGGGCGCAGCGGGGACGACAGCCAGCGGGTGCGTG
CGCTCTTAGAGAAACTTTCCCTGTCAAAGGCTCCGGGGGGCGCGGGTGTCCCCCGCTTGC
CAGAGCCCTGTTGCGGCCCCGAAACTTGTGCGCGCAGCCCAAACTAACCTCACGTGAAGT
GACGGACTGTTCTATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGC
CTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACA
GAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAA
GAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCT
GGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCA
GTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCG
CGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCC
GGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAG
CGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTT
CAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGC
CTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCC
CGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCC
CGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGA
GAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAG
AATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTC
CACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGT
TAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGAAGAGAGACCGT
CGGGGGCTGAGGGGCAACGAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002228 unedited
GAATTCGGCACGAGGGTGGCTGAAGCAGCGAGGCGGGAGTGGAGGTGCGCGGAGTCAGGC
AGACAGAACAGAACACAGCCAGCCAGCCAGGTCGGCAGTATAGTCCGAACTGCAAATCTT
ATTTTCTTTTCACCTTCTCTCTAACTGCCCAGAAGCTAGCGCCTGTGGCTCCCGGGCTGG
TGTTTCGGGAGTGTCCAGAGAGCCTGGTCTCCAGCCGCCCCCGGGAGGAGAGCCCTGCTG
CCCAGGCGCTGTTGACAGCGGCGGAAAGCAGCGGTACCCACGCGCCCGCCGGGGGAAGTC
GGCGAGCGGCTGCAGCAGCAAAGAACTTTCCCGGCTGGGAGGACCGGAGACAAGTGGCAG
AGTCCCGGAGCGAACTTTTGCAAGCCTTTCCTGCGTCTTAGGCTTCTCCACGGCGGTAAA
GACCAGAAGGCGGCGGAGAGCCACGCAAGAGAAGAAGGACGTGCGCTCAGCTTCGCTCGC
ACCGGTTGTTGAACTTGGGCGAGCGCGAGCCGCGGCTGCCGGGCGCCCCCTCCCCCTAGC
AGCGGAGGAGGGGACAAGTCGTCGGAGTCCGGGCGGCCAGACCCNNGCGCGGCCGGCACT
GCANGGGTCGCACTGATCCGCTCCGCGGGGAGAGCCGCTGCTTGGGAAGTGAGGTCGCCT
GCGGGACTCGAGAACCGCTGCGCCGAGAGCGCTCAGTGAGTGACCGCGACTTTTCAAGCC
GGNTANCGCGCGCGAGTCCACAGTTAAAAGTGCGGGAGGCATCTTATTTAACCCTGCGCT
CCCTGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002228 unedited
TTAGCTATGGACCCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTCGTTGC
CCCTCAGCCCCCGACGGTCTCTCTTCAAAATGTTTGCAACTGCTGCGTTAGCATGAGTTG
GCACCCACTGTTAACGTGGTTCATGACTTTCTGTTTAAGCTGTGCCACCTGTTCCCTGAG
CATGTTGGCCGTGGACGCCAGCTCCGAGTTCTGAGCTTTCAAGGTTTTCACTTTTTCCTC
CAGCCGGGCGATTCTCTCCAGCTTCCTTTTTCGGCACTTGGAGGCAGCGATGCGGTTCCT
CATGCGCTTCCTCTCCGCCTTGATCCGCTCCTGGGACTCCATGTCGATGGGGGACAGGGG
CGGTGTCTCGCCGGGCATCTCGGGCACTGTCTGAGGCTCCTCCTTCAGGGCCTGCAGCCG
CGGGTGCTGCACGGGCATCTGCTGGGGCAGGTGGTGCGGCGGCTGCTGCTGCTGCTGGGG
TTGCGCGGGAAAGGCCAGGCCGGCCGCGCCGTAGGAGGGCGCCCCGCCGCCGCTGCTCAN
CGCGCCTGGGTTGAAGTTGCTGAGGTTTGCGTAAACCGGCGGCTCGCTGTGCAGGCTGGC
GCTGAANCCGCCGCTGCCGCTGCCCCCCTGCCACCGAGGCTACCGCGGGAGCCACCATGC
CTGCCCCGTTGACCGGCTGCGCCGCCGACGTGACGCTGGGCAGCGTGTTCTGGCTGTGCC
AATTCGCCAGGGCGCGCACGAAACCCTTCGCGAAGCCCTCCTGCTCATCTGTCACGTTCT
TGGGGCACAGGAACTGGGGTGGGGGTCGCGGTGGGGGGGAATTACCCCCTTCTTGGACTG
GATTATAAGGGCCTTCACTTGGGGGGAGGCCAGCTTGAGAATCCCCACCTCGGGGAGGTG
GGGGGGGCTCATTTCTTGGTCCCGGGGGGCGGGTTCAAGCTCAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002228
ORF Size 996 bp
Insert Size 2080
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002228.3, NP_002219
RefSeq Size 3338
Locus ID 3725
Cytogenetics 1p32.1
Domains BRLZ, Jun
Protein Families ES Cell Differentiation/IPS, Transcription Factors, Druggable Genome
Protein Pathways MAPK signaling pathway, ErbB signaling pathway, Wnt signaling pathway, Focal adhesion, Toll-like receptor signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Neurotrophin signaling pathway, GnRH signaling pathway, Epithelial cell signaling in Helicobacter pylori infection, Pathways in cancer, Colorectal cancer, Renal cell carcinoma
Gene Summary This gene is the putative transforming gene of avian sarcoma virus 17. It encodes a protein which is highly similar to the viral protein, and which interacts directly with specific target DNA sequences to regulate gene expression. This gene is intronless and is mapped to 1p32-p31, a chromosomal region involved in both translocations and deletions in human malignancies. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations