CD73(NT5E) (NM_002526) Human Untagged Clone

CAT#: SC118577

NT5E (untagged)-Human 5'-nucleotidase, ecto (CD73) (NT5E), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CD73(NT5E) (NM_002526) Human Untagged Clone
Symbol NT5E
Synonyms CALJA; CD73; E5NT; eN; eNT; NT; NT5; NTE
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118577 sequence for NM_002526 edited (data generated by NextGen Sequencing)
ATGTGTCCCCGAGCCGCGCGGGCGCCCGCGACGCTACTCCTCGCCCTGGGCGCGGTGCTG
TGGCCTGCGGCTGGCGCCTGGGAGCTTACGATTTTGCACACCAACGACGTGCACAGCCGG
CTGGAGCAGACCAGCGAGGACTCCAGCAAGTGCGTCAACGCCAGCCGCTGCATGGGTGGC
GTGGCTCGGCTCTTCACCAAGGTTCAGCAGATCCGCCGCGCCGAACCCAACGTGCTGCTG
CTGGACGCCGGCGACCAGTACCAGGGCACTATCTGGTTCACCGTGTACAAGGGCGCCGAG
GTGGCGCACTTCATGAACGCCCTGCGCTACGATGCCATGGCACTGGGAAATCATGAATTT
GATAATGGTGTGGAAGGACTGATCGAGCCACTCCTCAAAGAGGCCAAATTTCCAATTCTG
AGTGCAAACATTAAAGCAAAGGGGCCACTAGCATCTCAAATATCAGGACTTTATTTGCCA
TATAAAGTTCTTCCTGTTGGTGATGAAGTTGTGGGAATCGTTGGATACACTTCCAAAGAA
ACCCCTTTTCTCTCAAATCCAGGGACAAATTTAGTGTTTGAAGATGAAATCACTGCATTA
CAACCTGAAGTAGATAAGTTAAAAACTCTAAATGTGAACAAAATTATTGCACTGGGACAT
TCGGGTTTTGAAATGGATAAACTCATCGCTCAGAAAGTGAGGGGTGTGGACGTCGTGGTG
GGAGGACACTCCAACACATTTCTTTACACAGGCAATCCACCTTCCAAAGAGGTGCCTGCT
GGGAAGTACCCATTCATAGTCACTTCTGATGATGGGCGGAAGGTTCCTGTAGTCCAGGCC
TATGCTTTTGGCAAATACCTAGGCTATCTGAAGATCGAGTTTGATGAAAGAGGAAACGTC
ATCTCTTCCCATGGAAATCCCATTCTTCTAAACAGCAGCATTCCTGAAGATCCAAGCATA
AAAGCAGACATTAACAAATGGAGGATAAAATTGGATAATTATTCTACCCAGGAATTAGGG
AAAACAATTGTCTATCTGGATGGCTCCTCTCAATCATGCCGCTTTAGAGAATGCAACATG
GGCAACCTGATTTGTGATGCAATGATTAACAACAACCTGAGACACGCGGATGAAATGTTC
TGGAACCACGTATCCATGTGCATTTTAAATGGAGGTGGTATCCGGTCGCCCATTGATGAA
CGCAACAATGGCACAATTACCTGGGAGAACCTGGCTGCTGTATTGCCCTTTGGAGGCACA
TTTGACCTAGTCCAGTTAAAAGGTTCCACCCTGAAGAAGGCCTTTGAGCATAGCGTGCAC
CGCTACGGCCAGTCCACTGGAGAGTTCCTGCAGGTGGGCGGAATCCATGTGGTGTATGAT
CTTTCCCGAAAACCTGGAGACAGAGTAGTCAAATTAGATGTTCTTTGCACCAAGTGTCGA
GTGCCCAGTTATGACCCTCTCAAAATGGACGAGGTATATAAGGTGATCCTCCCAAACTTC
CTGGCCAATGGTGGAGATGGGTTCCAGATGATAAAAGATGAATTATTAAGACATGACTCT
GGTGACCAAGATATCAACGTGGTTTCTACATATATCTCCAAAATGAAAGTAATTTATCCA
GCAGTTGAAGGTCGGATCAAGTTTTCCACAGGAAGTCACTGCCATGGAAGCTTTTCTTTA
ATATTTCTTTCACTTTGGGCAGTGATCTTTGTTTTATACCAATAG

Clone variation with respect to NM_002526.3
1126 a=>g
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002526 unedited
NGGTCGGAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGCCGGCTCG
CCCGCTTTCGCACCCAGTTCACGCGCCACAGCTATGTGTCCCCGAGCCGCGCGGGCGCCC
GCGACGCTACTCCTCGCCCTGGGCGCGGTGCTGTGGCCTGCGGCTGGCGCCTGGGAGCTT
ACGATTTTGCACACCAACGACGTGCACAGCCGGCTGGAGCAGACCAGCGAGGACTCCAGC
AAGTGCGTCAACGCCAGCCGCTGCATGGGTGGCGTGGCTCGGCTCTTCACCAAGGTTCAG
CAGATCCGCCGCGCCGAACCCAACGTGCTGCTGCTGGACGCCGGCGACCAGTACCAGGGC
ACCTATCTGGTTCACCGTGTACAAGGGCGCCGAGGTGGCGCACTTCATGAACGCCCTGCG
CTACGATGCCATGGCACTGGGAAATCATGAATTTGATAATGGTGTGGAAGGACTGATCGA
GCCACTCCTCAAAGAGGCCAAATTTCCAATTCTGAGTGCAAACATTAAAGCAAAGGGGCC
ACTAGCATCTCAAATATCAGGACTTTATTTGCCATATAAAGTTCTTCCTGTTGGTGATGA
AGTTGTGGGAATCGTTGGATACACTTCCAAAGAAACCCCTTTTCTCTCAAATCCAGGGAC
ANATTTAGTGTTTTGAAGATGAAATCACTGCATTACAACCTGAAGTAGATAAGTTAAAAA
CTCTAAATGTGAACAAANATATTGCACTGGGACATTCCGGGTTTTTGAAATGGATAAACT
CATCGCTCAAAAGTGAAGGGTGTNGGACCGTCCTGTTGGGAGGGACCTTCAACACATTTT
CTTACACAGGCAATCCCACCTCCCAAGAAGTGCCTGCTGGGTAAGACCCCATTATTAGTC
CTTTTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002526 unedited
GGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGAGCTTATCTTCAATTTTATTG
TTGGGAATCTACAATTGCAAAGTGGTTCAAAGTCATTTCTTATACCACTTCACAATACAC
ACACAGATTTAGGAAACTTAAAAAAAGTTCTTTAAAAAATTCTAATAGGATTTACCCTAT
TTTACTGGCCAAGTGTAAAAAATAAACCCTAAATGTGCCTTTCTCTAATTTTCCTTGTAC
AATCTTATTGACATTTTTTATAGCTAATCCATATATGCATAGAACCGAGGCTATTATTTT
GCTGCAACAACTTTTATAAAAAGGTTATGAAGTTTAAAAGTATATTTTGTATCAAGAGTA
CTTAATATTTGTAAACACTAAGAAACAAACATACTTCCTATCAAAACCTCTAGCTGCCAT
TTGCACACTGTTTTTAAGGTGAAGCCTCCCATTTCTTGAATTACTTATGCAGAGCTGAGC
AGGCTCATGTGGTTCCACTCCCACGTTAAGTATTTGTTCTTTGGGCATAGGTCATTTCAT
CAGCATGGGTATTTTCTGACCACCCACTCAGAGGGTCCCACTTTCCAGCAGAAGTTCTCA
TATCTGGGCTTAAGAATGATTTACAGTGACTGTTCAGATTTGGAGGCAGAGCGACTTAAA
AAATGTATACCTCTTCCTAAAGTCATTTATTTTCTTCGAGAACTCTGGACATTCCATAAC
TGGGTGTGTAGTATGAGTAGAATGAATTCAGTGCTAGCCTCTTGCTGGAGAGGACAAGTG
CANNGTTAAATTACAGCTTATGTTAAAAGGNTCTCTTCTCATGATACCTTCATGTANAAN
AAAGAGACAGAGGCANAGCTGATGGAATCTCATAAATAACAGCTAATGCCGTGTGTCACG
CACTATAGCTAACAGTATCTGTTAAACAGTGTAATGCCCTTNACTCTTGCTTTCTATATT
AAAAAGNCCTGGAGCCTGGTCTTCCCTTCTTN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002526
ORF Size 1725 bp
Insert Size 3270
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002526.1, NP_002517
RefSeq Size 3547
Locus ID 4907
Cytogenetics 6q14.3
Domains Metallophos, 5_nucleotidaseC
Protein Families ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Purine metabolism, Pyrimidine metabolism, Nicotinate and nicotinamide metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene is a plasma membrane protein that catalyzes the conversion of extracellular nucleotides to membrane-permeable nucleosides. The encoded protein is used as a determinant of lymphocyte differentiation. Defects in this gene can lead to the calcification of joints and arteries. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations