PCK2 (NM_004563) Human Untagged Clone

CAT#: SC117281

PCK2 (untagged)-Human phosphoenolpyruvate carboxykinase 2 (mitochondrial) (PCK2), nuclear gene encoding mitochondrial protein, transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PCK2 (NM_004563) Human Untagged Clone
Symbol PCK2
Synonyms PEPCK; PEPCK-M; PEPCK2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC117281 sequence for NM_004563 edited (data generated by NextGen Sequencing)
ATGGCCGCATTGTACCGCCCTGGCCTGCGGCTTAACTGGCATGGGCTGAGCCCCTTGGGC
TGGCCATCATGCCGTAGCATCCAGACCCTGCGAGTGCTTAGTGGAGATCTGGGCCAGCTT
CCCACTGGCATTCGAGATTTTGTAGAGCACAGTGCCCGCCTGTGCCAACCAGAGGGCATC
CACATCTGTGATGGAACTGAGGCTGAGAATACTGCCACACTGACCCTGCTGGAGCAGCAG
GGCCTCATCCGAAAGCTCCCCAAGTACAATAACTGCTGGCTGGCCCGCACAGACCCCAAG
GATGTGGCACGAGTAGAGAGCAAGACGGTGATTGTAACTCCTTCTCAGCGGGACACGGTA
CCACTCCCGCCTGGTGGGGCCCGTGGGCAGCTGGGCAACTGGATGTCCCCAGCTGATTTC
CAGCGAGCTGTGGATGAGAGGTTTCCAGGCTGCATGCAGGGCCGCACCATGTATGTGCTT
CCATTCAGCATGGGTCCTGTGGGCTCCCCGCTGTCCCGCATCGGGGTGCAGCTCACTGAC
TCAGCCTATGTGGTGGCAAGCATGCGTATTATGACCCGACTGGGGACACCTGTGCTTCAG
GCCCTGGGAGATGGTGACTTTGTCAAGTGTCTGCACTCCGTGGGCCAGCCCCTGACAGGA
CAAGGGGAGCCAGTGAGCCAGTGGCCGTGCAACCCAGAGAAAACCCTGATTGGCCACGTG
CCCGACCAGCGGGAGATCATCTCCTTCGGCAGCGGCTATGGTGGCAACTCCCTGCTGGGC
AAGAAGTGCTTTGCCCTACGCATCGCCTCTCGGCTGGCCCGGGATGAGGGCTGGCTGGCA
GAGCACATGCTGATCCTGGGCATCACCAGCCCTGCAGGGAAGAAGCGCTATGTGGCAGCC
GCCTTCCCTAGTGCCTGTGGCAAGACCAACCTGGCTATGATGCGGCCTGCACTGCCAGGC
TGGAAAGTGGAGTGTGTGGGGGATGATATTGCTTGGATGAGGTTTGACAGTGAAGGTCGA
CTCCGGGCCATCAACCCTGAGAACGGCTTCTTTGGGGTTGCCCCTGGTACCTCTGCCACC
ACCAATCCCAACGCCATGGCTACAATCCAGAGTAACACTATTTTTACCAATGTGGCTGAG
ACCAGTGATGGTGGCGTGTACTGGGAGGGCATTGACCAGCCTCTTCCACCTGGTGTTACT
GTGACCTCCTGGCTGGGCAAACCCTGGAAACCTGGTGACAAGGAGCCCTGTGCACATCCC
AACTCTCGATTTTGTGCCCCGGCTCGCCAGTGCCCCATCATGGACCCAGCCTGGGAGGCC
CCAGAGGGTGTCCCCATTGACGCCATCATCTTTGGTGGCCGCAGACCCAAAGGGGTACCC
CTGGTATACGAGGCCTTCAACTGGCGTCATGGGGTGTTTGTGGGCAGCGCCATGCGCTCT
GAGTCCACTGCTGCAGCAGAACACAAAGGGAAGATCATCATGCACGACCCATTTGCCATG
CGGCCCTTTTTTGGCTACAACTTCGGGCACTACCTGGAACACTGGCTGAGCATGGAAGGG
CGCAAGGGGGCCCAGCTGCCCCGTATCTTCCATGTCAACTGGTTCCGGCGTGACGAGGCA
GGGCACTTCCTGTGGCCAGGCTTTGGGGAGAATGCTCGGGTGCTAGACTGGATCTGCCGG
CGGTTAGAGGGGGAGGACAGTGCCCGAGAGACACCCATTGGGCTGGTGCCAAAGGAAGGA
GCCTTGGATCTCAGCGGCCTCAGAGCTATAGACACCACTCAGCTGTTCTCCCTCCCCAAG
GACTTCTGGGAACAGGAGGTTCGTGACATTCGGAGCTACCTGACAGAGCAGGTCAACCAG
GATCTGCCCAAAGAGGTGTTGGCTGAGCTTGAGGCCCTGGAGAGACGTGTGCACAAAATG
TGA

Clone variation with respect to NM_004563.2
362 a=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004563 unedited
CCATTTGTATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCCGGCTCCGCT
CGGTTCCTGGCCACCCCGCAGCCCCTGCCCAGGTGCCATGGCCGCATTGTACCGCCCTGG
CCTGCGGCTTAACTGGCATGGGCTGAGCCCCTTGGGCTGGCCATCATGCCGTAGCATCCA
GACCCTGCGAGTGCTTAGTGGAGATCTGGGCCAGCTTCCCACTGGCATTCGAGATTTTGT
AGAGCACAGTGCCCGCCTGTGCCAACCAGAGGGCATCCACATCTGTGATGGAACTGAGGC
TGAGAATACTGCCACACTGACCCTGCTGGAGCAGCAGGGCCTCATCCGAAAGCTCCCCAA
GTACAATAACTGCTGGCTGGCCCGCACAGACCCCAAGGATGTGGCACGAGTAGAGAGCAA
GACGGTGATTGTAACTCCTTCTCAGCGGGACACGGTACCACTCCCGCCTGGTGGGGCCCG
TGGGCAGCTGGGCAACTGGATGTCCCCAGCTGATTTCCAGCGAGCTGTGGATGAGAGGTT
TCCAGGCTGCATGCAGGGCCGCACCATGTATGTGCTTCCATTCAGCATGGGTCCTGTGGG
CTCCCCGCTGTCCCGCATCGGGGTGCAGCTCACTGACTCAGCCTATGTGGTGGCAAGCAT
GCGTATTATGACCCGACTGGGGACACCTGTGCTTCAGGCCCTGNGAGATGGTGACTNTGT
CAAGTGTCTGCACTCCGTGGGCCAGCCCCTGACAGGACAAGGNGAGCCAGTGAGCCAGTG
GCCGTGCCACCCAGAGAAACCCTGATTGGTCACGTGCCCGACCAGCGGGAGATCATCTCC
CTCGGCAGCGGCTATGGTGGGCACTCCCTGCTGGGNCAGAAGTGCTTTGCCCTACGCATC
GNCTCTCGGCTGCCCCGGNATGAGGNNNCTGCTGCANACACATGCTGATCCTGGCATCAC
AGACTGCAAGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004563 unedited
GACCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTGTGTAAAATAGATAAG
CATCTCTTATTATTGGACAGTCTTTGTGGGAAGGTCTATGGCACATTGAAGATGTTAGTT
AATATCAAATTGCTCATATTTTCTGCAAGGTGCCTTCCCTATTCCCAGATGAGGGTGCTA
TGTCCTCTTGCTAGACTAGGGCCTCAGGTCACATTTTGTGCACACGTCTCTCCAGGGCCT
CAAGCTCAGCCAACACCTCTTTGGGCAGATCCTGGTTGACCTGCTCTGTCAGGTAGCTCC
GAATGTCACGAACCTCCTGTTCCCAGAAGTCCTTGGGGAGGGAGAACAGCTGAGTGGTGT
CTATAGCTCTGAGGCCGCTGAGATCCAAGGCTCCTTCCTTTGGCACCAGCCCAATGGGTG
TCTCTCGGGCACTGTCCTCCCCCTCTAACCGCCGGCAGATCCAGTCTAGCACCCGAGCAT
TCTCCCCAAAGCCTGGCCACAGGAAGTGCCCTGCCTCGTCACGCCGGAACCAGTTGACAT
GGAAGATACGGGGCAGCTGGGCCCCCTTGCGCCCTTCCATGCTCAGCCAGTGTTCCAGGT
AGTGCCCGAAGTTGTAGCCAAAAAAGGGCCGCATGGCAAATGGGTCGTGCATGATGATCT
TCCCTTTGTGTTCTGCTGCAGCAGTGGACTCAGAGCGCATGGCGCTGCCCACAAACACCC
CATGACGCCAGTTGAAGGCCTCGTATACCAGGGGTACCCCCTTTGGGTCTGCGGCCACCA
AGATGATGGCGTCAATGGGGACACCCCCTCTGGGCCTNCCCAGCCTGGTCCATGATGGNG
GCACTGGCGAGCCCGNGCACAAATCGAGAGTTGGATGTGACAGGGCTCCTTGTACCAGTT
NCCAGGTTGCCCAGCAGNAGTACAGTACACCAGNTGGAAAGCTGTCATGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004563
ORF Size 1923 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004563.2, NP_004554
RefSeq Size 2221
Locus ID 5106
Cytogenetics 14q11.2-q12
Domains PEPCK
Protein Families ES Cell Differentiation/IPS
Protein Pathways Glycolysis / Gluconeogenesis, Citrate cycle (TCA cycle), Pyruvate metabolism, Metabolic pathways, PPAR signaling pathway, Insulin signaling pathway, Adipocytokine signaling pathway
Gene Summary This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.