UQCR11 (NM_006830) Human Untagged Clone

CAT#: SC115882

UQCR11 (untagged)-Human ubiquinol-cytochrome c reductase, complex III subunit XI (UQCR11), nuclear gene encoding mitochondrial protein

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name UQCR11 (NM_006830) Human Untagged Clone
Symbol UQCR11
Synonyms 0710008D09Rik; QCR10; UQCR
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_006830 edited
ATGGTGACCCGGTTCCTGGGCCCACGCTACCGGGAGCTGGTCAAGAACTGGGTCCCGACG
GCCTACACATGGGGCGCTGTGGGCGCCGTGGGGCTGGTGTGGGCCACCGATTGGCGGCTG
ATCCTGGACTGGGTACCTTACATCAATGGCAAGTTTAAGAAGGATAATTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006830 unedited
AATGCAGCATTTGTATACGATTCATATAGGCGGCCTGCGAATCGGCACGAGGGTCAGCTG
GACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACG
CTACCGGGAGCTGGTCAAGAACTGGGTCCCGCGGCCTACACATGGGGCGCTGTGGGCGCC
GTGGGGCTGGTGTGGGCCACCGATTGGCGGCTGATCCTGGACTGGGTACCTTACATCAAT
GGCAAGTTTAAGAAGGATAATTAATTACACAAACCCTTCACAGACTGCTCTGGTGCCTGG
TGGTGCTAGCTCCTCCCACCTCAGCACCTGCTGCATCTGGAGCAGCCCAAGCCTCAGGAT
GGACAAGAGGAAACCCACAGCTCAGCTTCAGGCTTCTTATGTTTCTGAAAACAGCTTGGA
TATTTTAATGCACGTTGCATTAAACCTCACTGAAACCTGCTCCGTGCCCGGATGTTGATC
ATGCTGGTGGCTTGGTTACTGTGACTGTAGCTGGAGTGGCACAGGTGACCCAGGCGTCCT
TTCAGCTCCAGAATGTTGCAAGTCTAGGAGAGTGTTCCAATGGCTGACAGAAACTGCCTA
TTTGAAATGGCTCATAAGTAGTATCTGCAGTGTGTTCATCCGTTGCTGCCTTAACAAGTC
ACCCACACGTAGTGGCTTAAAGCAACGAACATTCACTCTCTCACAGTCTGTGTCAGTCGG
GGATTTGGGAGTGATGTATCTGGGTGGTTGTGGCCCAGAGTCTCTCATGAGGTTGCAGTT
AAGACATCAGCCAAGGCCACTTCGTCTGACGAAGGCTCAACTGGGGCTGGAGCCACTTNC
AGCCAGTGCCCTCACGTGGCTGTCGGTGACGCCCCAGTTCCTTTCCATGGNGGGCCCATA
CC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006830 unedited
NTTCAGCTTGNACCCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTATCAG
AGACAGGGGCCTCTTTGTTGCCCAGGTTAGTACTGAACTCCTGGTTCAAGTGATGCCCCT
TCCTCAGCCTCCCAAAGTGTTGGGATTGTAGGCTGAGCCACCACTCCCAGCCTGTTCATT
TTTGTATCCCTAATGTGACAGTTTGAAATGTCTACCAATTCTGATATTCTTCCCTTCAAA
ACACAGAACCTCATTCTCCTCCCTCTGCACGTGGGCTGGGCCTGGGGGGCTTGCTTTTGA
TAAACAGGCTGTGGCGGAAGTGATCACGTGAGACTTCTCAGGGTGGCTCATAGAAGCACT
GTGGCTTGCTCCTTCCTCTCCCTTGGTTCACCTGCTCTGGGGAAGGCAGAGGCCATGCCG
TGAGGATGCTCAAGCAGCTTCGTGTAGGGGCCCCCATGGGAAGGAACTGTGGCTGTCACC
GACAGCCACGTGAGGGCACTGGCTTGGAAGTGGCTCCAGCCCCAGTTGAGCCTTCCTCAG
ACGAAGTGGCCTTGGCTGATGTCTTAACTGCAACCTCATGAGAGACTCTGGGCCACAACC
ACCCAGATACATCACTCCCAAATCCCCGACTGACACAGACTGTGAGAGAGTGAATGTTCG
TTGCTTTAAGCCACTACGTGTGGGTGACTTGTTAAGGCAGCAACGGATGAACACACTGCA
GATACTACTTATGAGCCATTTCAAATAGGCCAGTTCTGTCAGCCATTGGAACACTCTCCT
AGACTTGCAACATTTCTGGAGCTGAAAGGACGCCTGGGTCACCTTGTGCACTTCCGCTAC
AGTCACAGTAACAAAGCCACCACCTTGATCAACATCCGGCCCCGGACCAAGTTTCAGTGG
AGTTTAATGCACGTGCATTAAAATATTCAGCTGGTTTCAAAACT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006830
ORF Size 171 bp
Insert Size 1330
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006830.2, NP_006821
RefSeq Size 1305
Locus ID 10975
Cytogenetics 19p13.3
Protein Families Transmembrane
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Cardiac muscle contraction, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary This gene encodes the smallest known component of the ubiquinol-cytochrome c reductase complex, which forms part of the mitochondrial respiratory chain. The encoded protein may function as a binding factor for the iron-sulfur protein in this complex. [provided by RefSeq, Oct 2009].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.