Androgen Receptor(AR) (NM_000044) Human Untagged Clone

CAT#: SC114220

AR (untagged)-Human androgen receptor (AR), OriGene unique variant 1

USD 1,762.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Androgen Receptor(AR) (NM_000044) Human Untagged Clone
Symbol AR
Synonyms AIS; AR8; DHTR; HUMARA; HYSP1; KD; NR3C4; SBMA; SMAX1; TFM
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000044 edited
AGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCG TCAGAATT
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACG AGGAAAAACAAAAAAG
CCGAAATAAAAGAAAAAGATAATAACTCAGTTCT TATTTGCACCTACTTCAGTGGACA
CTGAATTTGGAAGGTGGAGGATTTTG TTTTTTTCTTTTAAGATCTGGGCATCTTTTGA
ATCTACCCTTCAAGTATT AAGAGACAGACTGTGAGCCTAGCAGGGCAGATCTTGTCCA
CCGTGTGTCT TTTTCTGCACGAGACTTTGAGGCTGTCAGAGCGCTTTTTGCGTGGTTG
CT CCCGCAAGTTTCCTTCTCTGGAGCTTCCCGCAGGTGGGCAGCTAGCTGCA GCGA
CTACCGCATCATCACAGCCTGTTGAACTCTTCTGAGCAAGAGAAGG GGAGGCGGGGTA
AGGGAAGTAGGTGGAAGATTCAGCCAAGCTCAAGGATG GAAGTGCAGTTAGGGCTGGG
AAGGGTCTACCCTCGGCCGCCGTCCAAGAC CTACCGAGGAGCTTTCCAGAATCTGTTC
CAGAGCGTGCGCGAAGTGATCC AGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAGCG
CAGCACCTCCCGGC GCCAGTTTGCTGCTGCTGCAGCAGCAGCAGCAGCAGCAGCAGCA
GCAGCA GCAGCAGCAGCAGCAGCAGCAGCAGCAAGAGACTAGCCCCAGGCAGCAGC
AGCAGCAGCAGGGTGAGGATGGTTCTCCCCAAGCCCATCGTAGAGGCCCC ACAGGCTA
CCTGGTCCTGGATGAGGAACAGCAACCTTCACAGCCGCAGTC GGCCCTGGAGTGCCAC
CCCGAGAGAGGTTGCGTCCCAGAGCCTGGAGCCG CCGTGGCCGCCAGCAAGGGGCTGC
CGCAGCAGCTGCCAGCACCTCCGGAC GAGGATGACTCAGCTGCCCCATCCACGTTGTC
CCTGCTGGGCCCCACTTT CCCCGGCTTAAGCAGCTGCTCCGCTGACCTTAAAGACATC
CTGAGCGAGG CCAGCACCATGCAACTCCTTCAGCAACAGCAGCAGGAAGCAGTATCCG
AA GGCAGCAGCAGCGGGAGAGCGAGGGAGGCCTCGGGGGCTCCCACTTCCTC CAAG
GACAATTACTTAGGGGGCACTTCGACCATTTCTGACAACGCCAAGG AGTTGTGTAAGG
CAGTGTCGGTGTCCATGGGCCTGGGTGTGGAGGCGTTG GAGCATCTGAGTCCAGGGGA
ACAGCTTCGGGGGGATTGCATGTACGCCCC ACTTTTGGGAGTTCCACCCGCTGTGCGT
CCCACTCCTTGTGCCCCATTGG CCGAATGCAAAGGTTCTCTGCTAGACGACAGCGCAG
GCAAGAGCACTGAA GATACTGCTGAGTATTCCCCTTTCAAGGGAGGTTACACCAAAGG
GCTAGA AGGCGAGAGCCTAGGCTGCTCTGGCAGCGCTGCAGCAGGGAGCTCCGGGA
CACTTGAACTGCCGTCTACCCTGTCTCTCTACAAGTCCGGAGCACTGGAC GAGGCAGC
TGCGTACCAGAGTCGCGACTACTACAACTTTCCACTGGCTCT GGCCGGACCGCCGCCC
CCTCCGCCGCCTCCCCATCCCCACGCTCGCATCA AGCTGGAGAACCCGCTGGACTACG
GCAGCGCCTGGGCGGCTGCGGCGGCG CAGTGCCGCTATGGGGACCTGGCGAGCCTGCA
TGGCGCGGGTGCAGCGGG ACCCGGTTCTGGGTCACCCTCAGCCGCCGCTTCCTCATCC
TGGCACACTC TCTTCACAGCCGAAGAAGGCCAGTTGTATGGACCGTGTGGTGGTGGTG
GG GGTGGTGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG CGGC
GGCGAGGCGGGAGCTGTAGCCCCCTACGGCTACACTCGGCCCCCTC AGGGGCTGGCGG
GCCAGGAAAGCGACTTCACCGCACCTGATGTGTGGTAC CCTGGCGGCATGGTGAGCAG
AGTGCCCTATCCCAGTCCCACTTGTGTCAA AAGCGAAATGGGCCCCTGGATGGATAGC
TACTCCGGACCTTACGGGGACA TGCGTTTGGAGACTGCCAGGGACCATGTTTTGCCCA
TTGACTATTACTTT CCACCCCAGAAGACCTGCCTGATCTGTGGAGATGAAGCTTCTGG
GTGTCA CTATGGAGCTGTCACATGTGGAAGCTGCAAGGTCTTCTTCAAAAGAGCCG
CTGAAGGGAAACAGAAGTACCTGTGCGCCAGCAGAAATGATTGCACTATT GATAAATT
CCGAAGGAAAAATTGTCCATCTTGTCGTCTTCGGAAATGTTA TGAAGCAGGGATGACT
CTGGGAGCCCGGAAGCTGAAGAAACTTGGTAATC TGAAACTACAGGAGGAAGGAGAGG
CTTCCAGCACCACCAGCCCCACTGAG GAGACAACCCAGAAGCTGACAGTGTCACACAT
TGAAGGCTATGAATGTCA GCCCATCTTTCTGAATGTCCTGGAAGCCATTGAGCCAGGT
GTAGTGTGTG CTGGACACGACAACAACCAGCCCGACTCCTTTGCAGCCTTGCTCTCTA
GC CTCAATGAACTGGGAGAGAGACAGCTTGTACACGTGGTCAAGTGGGCCAA GGCC
TTGCCTGGCTTCCGCAACTTACACGTGGACGACCAGATGGCTGTCA TTCAGTACTCCT
GGATGGGGCTCATGGTGTTTGCCATGGGCTGGCGATCC TTCACCAATGTCAACTCCAG
GATGCTCTACTTCGCCCCTGATCTGGTTTT CAATGAGTACCGCATGCACAAGTCCCGG
ATGTACAGCCAGTGTGTCCGAA TGAGGCACCTCTCTCAAGAGTTTGGATGGCTCCAAA
TCACCCCCCAGGAA TTCCTGTGCATGAAAGCACTGCTACTCTTCAGCATTATTCCAGT
GGATGG GCTGAAAAATCAAAAATTCTTTGATGAACTTCGAATGAACTACATCAAGG
AACTCGATCGTATCATTGCATGCAAAAGAAAAAATCCCACATCCTGCTCA AGACGCTT
CTACCAGCTCACCAAGCTCCTGGACTCCGTGCAGCCTATTGC GAGAGAGCTGCATCAG
TTCACTTTTGACCTGCTAATCAAGTCACACATGG TGAGCGTGGACTTTCCGGAAATGA
TGGCAGAGATCATCTCTGTGCAAGTG CCCAAGATCCTTTCTGGGAAAGTCAAGCCCAT
CTATTTCCACACCCAGTG AAGCATTGGAAACCCTATTTCCCCACCCCAGCTCATGCCC
CCTTTCAGAT GTCTTCTGCCTGTTATAACTCTGCACTACTCCTCTGCAGTGCCTTGGG
GA ATTTCCTCTATTGATGTACAGTCTGTCATGAACATGTTCCTGAATTCTAT TTGC
TGGGCTTTTTTTTCTCTTTCTCTCCTTTCTTTTTCTTCTTCCCTCC CTATCTAACCCT
CCCATGGCACCTTCAGACTTTGCTTCCCATTGTGGCTC CTATCTGTGTTTTGAATGGT
GTTGTATGCCTTTAAATCTGTGATGATCCT CATATGGCCCAGTGTCAAGTTGTGCTTG
TTTACAGCACTACTCTGTGCCA GCCACACAAACGTTTACTTATCTTATGCCACGGGAA
GTTTAGAGAGCTAA GATTATCTGGGGAAATCAAAACAAAAACAAGCAAACAAAAAAAA
AAAAAA AAAACTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGA
TCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000044 unedited
CCCCTGTTCAGGAATATTTGTNAATACGAACTNCACTATGAGGGNCTGGCCGCGNAATTC
GGCACGAGGGAAAAACAAAAAAGCCGAAATAAAAGAAAAAGAAATAACTCAGTTCTTATT
TGCACCTACTTCAGTGGACACTGAATTTGGAAGGTGGAGGATTTTGTTTTTTTCTTTTAA
GATCTGGGCATCTTTTGAATCTACCCTTCAAGTATTAAGAGACAGACTGTGAGCCTAGCA
GGGCAGATCTTGTCCACCGTGTGTCTTTTTCTGCACGAGACTTTGAGGCTGTCAGAGCGC
TTTTTGCGTGGTTGCTCCCGCAAGTTTCCTTCTCTGGAGCTTCCCGCAGGTGGGCAGCTA
GCTGCAGCGACTACCGCATCATCACAGCCTGTTGAACTCTTCTGAGCAAGAGAAGGGGAG
GCGGGGTAAGGGAAGTAGGTGGAAGATTCAGCCAAGCTCAAGGATGGAAGTGCAGTTAGG
GCTGGGAAGGGTCTACCCTCGGCCGCCGTCCAAGACCTACCGAGGAGCTTTCCAGAATCT
GTTCCAGAGCGTGCGCGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGAG
CGCAGCACCTCCCGGCGCCAGTTTGCTGCTGCTGCAGCAGCAGCAGCAGCAGCAGCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAAGAGACTAGCCCCAGGCAGCAGCAGCA
GCAGCAGGGTGAGGATGGTTCTCCCCAAGCCCATCGTAGAGGCCCCACAGGCTACCTGGT
CCTGGATGAGGAACAGNCACCTTCACAGCCGCAGTCGGCCCTGGAGTGCCACCCCGAGAG
AGGTTGCGTCCCTAGAGCTGNAGCCGCCGTGGCCGCCAGCAGGNGCTGCCGCAGCAGCTG
CCAGCACTTCTGAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000044 unedited
GGGGGGGNGGGCCCCCNCCCCCATTTTAAANNNNNNTTTTGTGTAGNCCGCGGCCGCTTT
CTANNATCGAGTTTTTTTTTTTTTTTTTTGTTTGCTTGTTTTTGTTTTGATTTCCCCAGA
TAATCTTAGCTCTCTAAACTTCCCGTGGCATAAGATAAGTAAACGTTTGTGTGGCTGGCA
CAGAGTAGTGCTGTAAACAAGCACAACTTGACACTGGGCCATATGAGGATCATCACAGAT
TTAAAGGCATACAACACCATTCAAAACACAGATAGGAGCCACAATGGGAAGCAAAGTCTG
AAGGTGCCATGGGAGGGTTAGATAGGGAGGGAAGAAGAAAAAGAAAGGAGAGAAAGAGAA
AAAAAAGCCCAGCAAATAGAATTCAGGAACATGTTCATGACAGACTGTACATCAATAGAG
GAAATTCCCCAAGGCACTGCAGAGGAGTAGTGCAGAGTTATAACAGGCAGAAGACATCTG
AAAGGGGGCATGAGCTGGGGTGGGGAAATAGGGTTTCCAATGCTTCACTGGGTGTGGAAA
TAGATGGGCTTGACTTTCCCAGAAAGGATCTTGGGCACTTGCACAGAGATGATCTCTGCC
ATCATTTCCGGAAAGTCCACGCTCACCATGTGTGACTTGATTAGCAGGTCAAAAGTGAAC
TGATGCAGCTCTCTCGCAATAGGCTGCACGGAGTCCAGGAGCTTGGTGAGCTGGTAGAAG
CGTCTTGAGCANGATGTGGGATTTTTTCTTTTGCATGNCATGATACGATCGAGTTCCTTG
ATGTAGNTCATTCGAAGTTCATCAAAGAAATTTTGATTTTTCAGCCCATCCACTGGNATA
ATGCTGAAGAGTANCAGTGCTTTCATGCACAGGAAATTCTGGGGGGGTGATTTTGNAGCC
ATCCAAACTCCTGAAAGAAGTGCCTCATTCGGACACACTGCCTGTACCTCCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000044
ORF Size 2763 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000044.2, NP_000035
RefSeq Size 4314
Locus ID 367
Cytogenetics Xq12
Domains HOLI, Androgen_recep, zf-C4
Protein Families Nuclear Hormone Receptor, Transcription Factors, Druggable Genome
Protein Pathways Oocyte meiosis, Pathways in cancer, Prostate cancer
Gene Summary The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (Kennedy disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Two alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2016].
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations